Incidental Mutation 'R1704:Vmn2r9'
ID189960
Institutional Source Beutler Lab
Gene Symbol Vmn2r9
Ensembl Gene ENSMUSG00000091624
Gene Namevomeronasal 2, receptor 9
SynonymsEG435864
MMRRC Submission 039737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108842947-108852510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108846400 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 461 (D461G)
Ref Sequence ENSEMBL: ENSMUSP00000129520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170419]
Predicted Effect probably damaging
Transcript: ENSMUST00000170419
AA Change: D461G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129520
Gene: ENSMUSG00000091624
AA Change: D461G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 77 412 8.1e-29 PFAM
Pfam:NCD3G 507 561 2.3e-16 PFAM
Pfam:7tm_3 592 829 3.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176157
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nf1 T A 11: 79,463,301 probably null Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Vmn2r9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Vmn2r9 APN 5 108848024 missense possibly damaging 0.79
IGL00972:Vmn2r9 APN 5 108849037 missense probably benign 0.02
IGL01102:Vmn2r9 APN 5 108842945 unclassified probably null
IGL01892:Vmn2r9 APN 5 108847834 missense probably damaging 1.00
IGL02086:Vmn2r9 APN 5 108847567 missense probably damaging 1.00
IGL02118:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02119:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02120:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02121:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02123:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02131:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02132:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02171:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02185:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02186:Vmn2r9 APN 5 108843636 missense probably damaging 1.00
IGL02346:Vmn2r9 APN 5 108842984 missense probably benign 0.07
IGL02508:Vmn2r9 APN 5 108848201 missense possibly damaging 0.70
IGL02815:Vmn2r9 APN 5 108842990 missense possibly damaging 0.69
IGL03077:Vmn2r9 APN 5 108848307 splice site probably benign
IGL03269:Vmn2r9 APN 5 108847954 missense probably damaging 1.00
IGL03293:Vmn2r9 APN 5 108848131 missense probably damaging 1.00
R0112:Vmn2r9 UTSW 5 108843125 missense probably damaging 1.00
R0328:Vmn2r9 UTSW 5 108847539 missense probably benign 0.11
R0382:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R0521:Vmn2r9 UTSW 5 108848288 nonsense probably null
R0975:Vmn2r9 UTSW 5 108843303 missense probably damaging 1.00
R1216:Vmn2r9 UTSW 5 108847574 missense probably damaging 1.00
R1458:Vmn2r9 UTSW 5 108848984 missense probably benign 0.44
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1469:Vmn2r9 UTSW 5 108843828 missense probably benign
R1967:Vmn2r9 UTSW 5 108847522 missense probably benign 0.03
R1991:Vmn2r9 UTSW 5 108846439 missense probably damaging 0.99
R2410:Vmn2r9 UTSW 5 108848257 missense probably damaging 1.00
R3419:Vmn2r9 UTSW 5 108846433 missense probably damaging 0.96
R3852:Vmn2r9 UTSW 5 108848131 missense probably damaging 1.00
R3873:Vmn2r9 UTSW 5 108847835 missense probably benign 0.14
R3905:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3908:Vmn2r9 UTSW 5 108847919 missense probably benign 0.37
R3921:Vmn2r9 UTSW 5 108849055 missense probably benign
R4156:Vmn2r9 UTSW 5 108847877 missense possibly damaging 0.64
R4477:Vmn2r9 UTSW 5 108846277 missense probably benign
R4478:Vmn2r9 UTSW 5 108846277 missense probably benign
R4544:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4546:Vmn2r9 UTSW 5 108847685 missense probably benign 0.00
R4627:Vmn2r9 UTSW 5 108847597 missense probably damaging 1.00
R5215:Vmn2r9 UTSW 5 108846485 missense probably benign 0.03
R5361:Vmn2r9 UTSW 5 108848063 missense probably damaging 1.00
R5587:Vmn2r9 UTSW 5 108847561 missense probably damaging 1.00
R6054:Vmn2r9 UTSW 5 108848260 missense probably damaging 0.99
R6106:Vmn2r9 UTSW 5 108845036 missense probably benign
R6125:Vmn2r9 UTSW 5 108842970 missense probably benign 0.01
R6137:Vmn2r9 UTSW 5 108849016 missense probably benign 0.00
R6920:Vmn2r9 UTSW 5 108849046 missense possibly damaging 0.72
R7579:Vmn2r9 UTSW 5 108845082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- accacagagctatgacttcagTGCTA -3'
(R):5'- ACTTACAGACATTCAGACTTCCCTTCCT -3'

Sequencing Primer
(F):5'- agctatgacttcagTGCTATTACTTC -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-05-14