Incidental Mutation 'R1704:Aldh1l2'
ID 189979
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 039737-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1704 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83344524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 341 (A341T)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably benign
Transcript: ENSMUST00000020497
AA Change: A454T

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: A454T

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143793
Predicted Effect probably benign
Transcript: ENSMUST00000146640
AA Change: A341T

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: A341T

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,146,164 (GRCm39) H511Y probably benign Het
Apon T C 10: 128,090,865 (GRCm39) F181S probably damaging Het
Avpr1b T A 1: 131,537,242 (GRCm39) L342Q possibly damaging Het
Cacna1c A T 6: 118,579,107 (GRCm39) H1810Q probably benign Het
Camta1 T C 4: 151,159,681 (GRCm39) Y1593C probably damaging Het
Cdh23 T A 10: 60,150,390 (GRCm39) I2527F probably damaging Het
Cep192 T A 18: 67,989,327 (GRCm39) S1825T probably damaging Het
Cntnap4 T A 8: 113,484,155 (GRCm39) W403R probably damaging Het
Crppa A G 12: 36,571,493 (GRCm39) E279G probably benign Het
D630045J12Rik G A 6: 38,116,362 (GRCm39) P1753S probably benign Het
Dsg4 T C 18: 20,604,646 (GRCm39) Y1038H probably damaging Het
Fat1 C T 8: 45,478,613 (GRCm39) T2553I probably damaging Het
Fem1c A T 18: 46,639,263 (GRCm39) N246K probably benign Het
Frmd8 T A 19: 5,919,510 (GRCm39) Q179L probably benign Het
Gbp10 A G 5: 105,372,217 (GRCm39) F181S probably damaging Het
Hfe T C 13: 23,888,391 (GRCm39) Y265C probably damaging Het
Kifap3 A G 1: 163,656,765 (GRCm39) N362D possibly damaging Het
Lima1 A G 15: 99,717,617 (GRCm39) F130L probably benign Het
Lipo3 A T 19: 33,757,743 (GRCm39) V242E possibly damaging Het
Nf1 T A 11: 79,354,127 (GRCm39) probably null Het
Nos1ap C G 1: 170,165,781 (GRCm39) E161Q probably damaging Het
Or1q1 A T 2: 36,886,896 (GRCm39) I25F probably benign Het
Or2t43 A T 11: 58,457,580 (GRCm39) M197K probably damaging Het
Pde4dip C T 3: 97,661,576 (GRCm39) V611I probably benign Het
Pdk2 T C 11: 94,919,376 (GRCm39) I300V possibly damaging Het
Polr2b A G 5: 77,490,407 (GRCm39) D849G possibly damaging Het
Polr3a G A 14: 24,534,188 (GRCm39) Q106* probably null Het
Prr14l G T 5: 32,987,626 (GRCm39) A623D probably benign Het
Rab43 A C 6: 87,788,363 (GRCm39) probably null Het
Sart3 G A 5: 113,884,068 (GRCm39) T648M probably benign Het
Scn10a T C 9: 119,438,460 (GRCm39) D1803G probably damaging Het
Sec11a A T 7: 80,584,848 (GRCm39) S30T possibly damaging Het
Sez6l2 G A 7: 126,557,513 (GRCm39) G309E probably damaging Het
Snx14 A C 9: 88,295,591 (GRCm39) D191E probably damaging Het
Sox6 A T 7: 115,076,183 (GRCm39) N777K possibly damaging Het
Susd4 A G 1: 182,681,678 (GRCm39) N173S probably damaging Het
Tex10 C T 4: 48,456,800 (GRCm39) R637Q probably benign Het
Tgfbrap1 G T 1: 43,093,816 (GRCm39) Q559K probably benign Het
Tmco1 T C 1: 167,153,506 (GRCm39) S129P possibly damaging Het
Tmprss11a T C 5: 86,576,561 (GRCm39) T97A probably benign Het
Tnni3k G A 3: 154,533,145 (GRCm39) A774V probably benign Het
Tshz3 T C 7: 36,470,785 (GRCm39) S925P possibly damaging Het
Ush2a T C 1: 188,553,993 (GRCm39) V3494A probably damaging Het
Vmn2r9 T C 5: 108,994,266 (GRCm39) D461G probably damaging Het
Zan A T 5: 137,432,264 (GRCm39) C2344* probably null Het
Zfp629 A G 7: 127,210,036 (GRCm39) I591T probably benign Het
Zfp955a G A 17: 33,460,699 (GRCm39) R478* probably null Het
Zmym1 A T 4: 126,942,177 (GRCm39) I737N probably damaging Het
Zranb3 T C 1: 128,019,740 (GRCm39) M1V probably null Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATGAGTCTGAAGTACACCCC -3'
(R):5'- GAATCCCACCAAGCTGACCTCTTTC -3'

Sequencing Primer
(F):5'- CTGCTAGGCACTGATCTAAATTC -3'
(R):5'- caccagatgccctggaac -3'
Posted On 2014-05-14