Incidental Mutation 'R1704:Ispd'
ID189984
Institutional Source Beutler Lab
Gene Symbol Ispd
Ensembl Gene ENSMUSG00000043153
Gene Nameisoprenoid synthase domain containing
Synonyms
MMRRC Submission 039737-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location36381450-36689503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36521494 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 279 (E279G)
Ref Sequence ENSEMBL: ENSMUSP00000152872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062041] [ENSMUST00000221177] [ENSMUST00000221452] [ENSMUST00000223205]
Predicted Effect probably benign
Transcript: ENSMUST00000062041
AA Change: E329G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061646
Gene: ENSMUSG00000043153
AA Change: E329G

DomainStartEndE-ValueType
Pfam:IspD 45 277 2.5e-40 PFAM
Pfam:NTP_transf_3 47 274 3.1e-11 PFAM
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221177
AA Change: E230G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000221452
AA Change: E329G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223205
AA Change: E279G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase-like protein. Mutations in this gene are the cause of Walker-Warburg syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit neonatal lethality due to respiratory failure, abnormal axon guidance and fasciculation, abnormal dorsal funiculus, detachment of radial glial cell endfeet and neuronal heterotopias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Lipo1 A T 19: 33,780,343 V242E possibly damaging Het
Nf1 T A 11: 79,463,301 probably null Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Ispd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ispd APN 12 36473177 missense probably damaging 1.00
IGL01845:Ispd APN 12 36547919 missense probably benign 0.10
R0329:Ispd UTSW 12 36381838 missense possibly damaging 0.71
R0513:Ispd UTSW 12 36390468 missense probably damaging 1.00
R0798:Ispd UTSW 12 36521999 missense probably benign 0.26
R1676:Ispd UTSW 12 36476721 missense probably benign 0.02
R1937:Ispd UTSW 12 36390368 missense probably benign 0.13
R1987:Ispd UTSW 12 36521996 missense probably damaging 1.00
R4518:Ispd UTSW 12 36473180 missense possibly damaging 0.81
R5726:Ispd UTSW 12 36547830 missense probably damaging 0.99
R6508:Ispd UTSW 12 36426299 missense possibly damaging 0.92
R7315:Ispd UTSW 12 36390374 missense probably benign 0.00
R7395:Ispd UTSW 12 36501995 missense possibly damaging 0.86
R7819:Ispd UTSW 12 36381903 missense probably benign 0.00
R8392:Ispd UTSW 12 36390498 missense probably damaging 1.00
R8810:Ispd UTSW 12 36390482 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGTATGCTGCAAGGTTCCATGAG -3'
(R):5'- TCGAGGATACGCAGTAACTTCCTGG -3'

Sequencing Primer
(F):5'- GAGTTTATAGAAGATTTGCTGCTTTG -3'
(R):5'- GTCTCCAATGACTCCAACCA -3'
Posted On2014-05-14