Incidental Mutation 'R1704:Lipo1'
ID189995
Institutional Source Beutler Lab
Gene Symbol Lipo1
Ensembl Gene ENSMUSG00000024766
Gene Namelipase, member O1
Synonyms
MMRRC Submission 039737-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1704 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location33517740-33590308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33780343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 242 (V242E)
Ref Sequence ENSEMBL: ENSMUSP00000136249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178735]
Predicted Effect probably benign
Transcript: ENSMUST00000148137
SMART Domains Protein: ENSMUSP00000118385
Gene: ENSMUSG00000079342

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 2.8e-21 PFAM
Pfam:Hydrolase_4 76 239 4.3e-8 PFAM
Pfam:Abhydrolase_1 80 219 2.2e-17 PFAM
Pfam:Abhydrolase_5 80 233 8.7e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178735
AA Change: V242E

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136249
Gene: ENSMUSG00000079342
AA Change: V242E

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 1.3e-20 PFAM
Pfam:Hydrolase_4 72 231 3.5e-8 PFAM
Pfam:Abhydrolase_5 76 370 3.7e-10 PFAM
Pfam:Abhydrolase_1 76 376 6.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adad1 C T 3: 37,092,015 H511Y probably benign Het
Aldh1l2 C T 10: 83,508,660 A341T probably benign Het
Apon T C 10: 128,254,996 F181S probably damaging Het
Avpr1b T A 1: 131,609,504 L342Q possibly damaging Het
Cacna1c A T 6: 118,602,146 H1810Q probably benign Het
Camta1 T C 4: 151,075,224 Y1593C probably damaging Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Cep192 T A 18: 67,856,256 S1825T probably damaging Het
Cntnap4 T A 8: 112,757,523 W403R probably damaging Het
D630045J12Rik G A 6: 38,139,427 P1753S probably benign Het
Dsg4 T C 18: 20,471,589 Y1038H probably damaging Het
Fat1 C T 8: 45,025,576 T2553I probably damaging Het
Fem1c A T 18: 46,506,196 N246K probably benign Het
Frmd8 T A 19: 5,869,482 Q179L probably benign Het
Gbp10 A G 5: 105,224,351 F181S probably damaging Het
Hfe T C 13: 23,704,408 Y265C probably damaging Het
Ispd A G 12: 36,521,494 E279G probably benign Het
Kifap3 A G 1: 163,829,196 N362D possibly damaging Het
Lima1 A G 15: 99,819,736 F130L probably benign Het
Nf1 T A 11: 79,463,301 probably null Het
Nos1ap C G 1: 170,338,212 E161Q probably damaging Het
Olfr224 A T 11: 58,566,754 M197K probably damaging Het
Olfr357 A T 2: 36,996,884 I25F probably benign Het
Pde4dip C T 3: 97,754,260 V611I probably benign Het
Pdk2 T C 11: 95,028,550 I300V possibly damaging Het
Polr2b A G 5: 77,342,560 D849G possibly damaging Het
Polr3a G A 14: 24,484,120 Q106* probably null Het
Prr14l G T 5: 32,830,282 A623D probably benign Het
Rab43 A C 6: 87,811,381 probably null Het
Sart3 G A 5: 113,746,007 T648M probably benign Het
Scn10a T C 9: 119,609,394 D1803G probably damaging Het
Sec11a A T 7: 80,935,100 S30T possibly damaging Het
Sez6l2 G A 7: 126,958,341 G309E probably damaging Het
Snx14 A C 9: 88,413,538 D191E probably damaging Het
Sox6 A T 7: 115,476,948 N777K possibly damaging Het
Susd4 A G 1: 182,854,113 N173S probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgfbrap1 G T 1: 43,054,656 Q559K probably benign Het
Tmco1 T C 1: 167,325,937 S129P possibly damaging Het
Tmprss11a T C 5: 86,428,702 T97A probably benign Het
Tnni3k G A 3: 154,827,508 A774V probably benign Het
Tshz3 T C 7: 36,771,360 S925P possibly damaging Het
Ush2a T C 1: 188,821,796 V3494A probably damaging Het
Vmn2r9 T C 5: 108,846,400 D461G probably damaging Het
Zan A T 5: 137,434,002 C2344* probably null Het
Zfp629 A G 7: 127,610,864 I591T probably benign Het
Zfp955a G A 17: 33,241,725 R478* probably null Het
Zmym1 A T 4: 127,048,384 I737N probably damaging Het
Zranb3 T C 1: 128,092,003 M1V probably null Het
Other mutations in Lipo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Lipo1 APN 19 33785683 missense probably damaging 1.00
IGL01916:Lipo1 APN 19 33784782 missense probably damaging 1.00
IGL03005:Lipo1 APN 19 33785736 missense possibly damaging 0.65
R0646:Lipo1 UTSW 19 33784769 nonsense probably null
R1772:Lipo1 UTSW 19 33787421 missense probably benign 0.45
R1862:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R1863:Lipo1 UTSW 19 33784692 missense probably damaging 1.00
R3801:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R3802:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R3803:Lipo1 UTSW 19 33784857 missense probably damaging 0.99
R4020:Lipo1 UTSW 19 33787404 missense probably benign 0.00
R4648:Lipo1 UTSW 19 33783460 missense probably damaging 1.00
R4775:Lipo1 UTSW 19 33780395 missense probably damaging 1.00
R4787:Lipo1 UTSW 19 33780349 missense probably benign 0.00
R4830:Lipo1 UTSW 19 33776587 missense probably damaging 0.99
R4951:Lipo1 UTSW 19 33782221 missense probably benign 0.01
R5799:Lipo1 UTSW 19 33777693 intron probably benign
R5853:Lipo1 UTSW 19 33782230 missense probably benign 0.37
R6235:Lipo1 UTSW 19 33783563 missense probably damaging 0.96
R6296:Lipo1 UTSW 19 33780337 missense probably benign 0.10
R6913:Lipo1 UTSW 19 33780305 missense probably benign 0.00
R7672:Lipo1 UTSW 19 33780385 missense probably benign 0.23
R7796:Lipo1 UTSW 19 33782234 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GGACAACAGACCTGTGCTCTTATGG -3'
(R):5'- TGATCCAAGCCAATCCACCTTTCAG -3'

Sequencing Primer
(F):5'- ATCTTAGCAacatacacacacacac -3'
(R):5'- GCAGCACACAGTAGTTTAGTC -3'
Posted On2014-05-14