Mutagenetix > Incidental Mutation

Incidental Mutation 'R1705:Rasef'

190005

Institutional Source

Beutler Lab

Gene Symbol

Rasef

Ensembl Gene

ENSMUSG00000043003

Gene Name

RAS and EF hand domain containing

Synonyms

RAB45

MMRRC Submission

039738-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.107) question?

Stock #

R1705 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73714579-73790994 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 73744064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 369 (Y369*)

Ref Sequence

ENSEMBL: ENSMUSP00000152127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]

AlphaFold

Q5RI75

Predicted Effect

probably null
Transcript: ENSMUST00000058292
AA Change: Y288*

SMART Domains

Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: Y288*

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
coiled coil region	55	251	N/A	INTRINSIC
RAB	429	598	4.94e-69	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000102837
AA Change: Y216*

SMART Domains

Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: Y216*

Domain	Start	End	E-Value	Type
coiled coil region	5	179	N/A	INTRINSIC
RAB	357	526	4.94e-69	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000222414
AA Change: Y369*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

90% (43/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Apaf1	A	G	10: 91,067,271		probably benign	Het
C130060K24Rik	A	T	6: 65,456,306	H370L	probably benign	Het
C1ql2	A	G	1: 120,342,542	T278A	probably damaging	Het
Card14	A	G	11: 119,338,406	H714R	possibly damaging	Het
Catsperd	T	C	17: 56,633,521	F69S	probably damaging	Het
Cep250	A	G	2: 155,963,786	E105G	probably damaging	Het
Coil	A	G	11: 88,974,136	Y63C	probably damaging	Het
Cox14	A	G	15: 99,727,678		probably null	Het
D230025D16Rik	T	C	8: 105,238,472		probably benign	Het
Defa24	T	C	8: 21,734,601	I22T	probably damaging	Het
F5	T	C	1: 164,217,490	Y2116H	possibly damaging	Het
Faf1	C	T	4: 109,677,002		probably benign	Het
Hectd4	A	G	5: 121,298,104	S1026G	probably benign	Het
Hgf	A	T	5: 16,615,802	H649L	probably benign	Het
Hmces	T	C	6: 87,933,301	V231A	probably damaging	Het
Kcnh4	A	G	11: 100,741,772	V963A	probably benign	Het
Ltbp1	T	C	17: 75,385,201		probably null	Het
Meox2	G	A	12: 37,167,494		probably benign	Het
Mis18bp1	A	C	12: 65,149,339	S550R	probably benign	Het
Nap1l4	A	T	7: 143,541,760	M1K	probably null	Het
Nav1	G	T	1: 135,584,599	T241N	probably damaging	Het
Nbeal2	A	G	9: 110,625,196	W2694R	probably damaging	Het
Olfr11	C	A	13: 21,639,161	D121Y	probably damaging	Het
Olfr1263	A	T	2: 90,015,511	I194F	possibly damaging	Het
Olfr744	A	T	14: 50,619,122	H300L	probably benign	Het
Pld1	G	A	3: 28,071,277		probably null	Het
Podn	T	C	4: 108,017,858	R164G	probably benign	Het
R3hdm1	T	A	1: 128,235,084	L966Q	probably damaging	Het
Ryr1	A	T	7: 29,078,564	V2176E	probably damaging	Het
Sec14l2	A	G	11: 4,103,980	L229P	possibly damaging	Het
Sec23a	T	C	12: 59,001,866	S157G	possibly damaging	Het
Slit2	T	A	5: 48,189,472	W219R	probably damaging	Het
Smarcad1	G	A	6: 65,056,416	E128K	probably damaging	Het
Stk31	A	T	6: 49,423,384	N381I	possibly damaging	Het
Svop	A	G	5: 114,042,295	Y264H	probably damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Ush2a	T	A	1: 188,874,869	I3987N	probably damaging	Het
Ush2a	T	A	1: 188,911,541	S4367T	probably benign	Het
Vdr	A	T	15: 97,867,171	V229D	probably damaging	Het
Ywhaz	G	T	15: 36,790,715	T88K	possibly damaging	Het
Zc3h10	A	T	10: 128,544,803	C228*	probably null	Het

Other mutations in Rasef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Rasef	APN	4	73771425	nonsense	probably null
IGL01329:Rasef	APN	4	73727645	missense	probably damaging	1.00
IGL01517:Rasef	APN	4	73769822	missense	probably benign	0.03
IGL02465:Rasef	APN	4	73734488	missense	probably damaging	1.00
IGL02676:Rasef	APN	4	73759729	missense	possibly damaging	0.69
IGL03137:Rasef	APN	4	73734483	nonsense	probably null
IGL03403:Rasef	APN	4	73734534	missense	probably damaging	1.00
BB001:Rasef	UTSW	4	73740929	critical splice donor site	probably null
BB011:Rasef	UTSW	4	73740929	critical splice donor site	probably null
P0033:Rasef	UTSW	4	73749852	missense	probably benign	0.26
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0035:Rasef	UTSW	4	73762854	splice site	probably benign
R0317:Rasef	UTSW	4	73748562	missense	probably damaging	1.00
R0686:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R0987:Rasef	UTSW	4	73734484	nonsense	probably null
R1115:Rasef	UTSW	4	73748604	missense	possibly damaging	0.85
R1511:Rasef	UTSW	4	73735748	missense	probably damaging	1.00
R1585:Rasef	UTSW	4	73740337	missense	probably damaging	1.00
R1646:Rasef	UTSW	4	73734549	missense	probably damaging	1.00
R1918:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R1919:Rasef	UTSW	4	73744114	missense	possibly damaging	0.94
R3819:Rasef	UTSW	4	73759705	missense	probably damaging	1.00
R3891:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R3892:Rasef	UTSW	4	73780397	missense	probably benign	0.03
R4344:Rasef	UTSW	4	73745089	missense	probably damaging	1.00
R4491:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4492:Rasef	UTSW	4	73734503	missense	probably damaging	1.00
R4594:Rasef	UTSW	4	73780389	missense	possibly damaging	0.47
R4915:Rasef	UTSW	4	73731459	missense	probably damaging	1.00
R5276:Rasef	UTSW	4	73735767	missense	probably null	1.00
R5359:Rasef	UTSW	4	73771328	missense	probably damaging	1.00
R5682:Rasef	UTSW	4	73740971	nonsense	probably null
R5693:Rasef	UTSW	4	73769839	missense	probably damaging	0.99
R6414:Rasef	UTSW	4	73740581	missense	probably benign	0.13
R6543:Rasef	UTSW	4	73780519	intron	probably benign
R6593:Rasef	UTSW	4	73745090	missense	probably damaging	1.00
R7078:Rasef	UTSW	4	73780389	missense	probably benign	0.01
R7083:Rasef	UTSW	4	73790984	missense	probably benign	0.26
R7106:Rasef	UTSW	4	73727627	missense	probably damaging	1.00
R7127:Rasef	UTSW	4	73744132	missense	probably damaging	1.00
R7329:Rasef	UTSW	4	73744137	missense	probably damaging	1.00
R7767:Rasef	UTSW	4	73734534	missense	probably damaging	1.00
R7891:Rasef	UTSW	4	73759698	missense	probably benign	0.00
R7891:Rasef	UTSW	4	73790964	missense	probably benign
R7924:Rasef	UTSW	4	73740929	critical splice donor site	probably null
R7997:Rasef	UTSW	4	73740562	missense	possibly damaging	0.78
R8554:Rasef	UTSW	4	73727607	missense	probably benign	0.03
R8832:Rasef	UTSW	4	73780321	intron	probably benign
R8850:Rasef	UTSW	4	73727603	missense	probably damaging	1.00
R8985:Rasef	UTSW	4	73790723	missense	possibly damaging	0.48
R9093:Rasef	UTSW	4	73780346	missense	probably benign	0.00
R9179:Rasef	UTSW	4	73744119	missense	probably damaging	0.97
R9199:Rasef	UTSW	4	73740388	missense	possibly damaging	0.88
R9300:Rasef	UTSW	4	73741156	missense	probably benign
R9310:Rasef	UTSW	4	73735719	critical splice donor site	probably null
R9415:Rasef	UTSW	4	73727645	missense	probably benign	0.00
R9482:Rasef	UTSW	4	73790696	missense	probably benign	0.00
R9719:Rasef	UTSW	4	73769865	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CATAATGCAACAGCACAGGACGTG -3'
(R):5'- TGGCATACTCAAAGAGCAAGCAGAC -3'

Sequencing Primer
(F):5'- GCCTATGGAGAAAATTACTGTTGTC -3'
(R):5'- GAGTCTGCCGTAGAGCTATATAAC -3'

Posted On

2014-05-14