Incidental Mutation 'R1705:Nap1l4'
ID190019
Institutional Source Beutler Lab
Gene Symbol Nap1l4
Ensembl Gene ENSMUSG00000059119
Gene Namenucleosome assembly protein 1-like 4
SynonymsNap2, D7Wsu30e, 2810410H14Rik
MMRRC Submission 039738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1705 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143513579-143549106 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 143541760 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000147062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072727] [ENSMUST00000207870] [ENSMUST00000207948] [ENSMUST00000208093] [ENSMUST00000208190] [ENSMUST00000209098]
Predicted Effect probably null
Transcript: ENSMUST00000072727
AA Change: M1K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072510
Gene: ENSMUSG00000059119
AA Change: M1K

DomainStartEndE-ValueType
Pfam:NAP 65 338 5e-103 PFAM
low complexity region 341 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207870
Predicted Effect probably benign
Transcript: ENSMUST00000207948
Predicted Effect probably null
Transcript: ENSMUST00000208093
AA Change: M1K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably null
Transcript: ENSMUST00000208190
AA Change: M1K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably null
Transcript: ENSMUST00000209098
AA Change: M1K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.9629 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 90% (43/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family which can interact with both core and linker histones. It can shuttle between the cytoplasm and nucleus, suggesting a role as a histone chaperone. This gene is one of several located near the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apaf1 A G 10: 91,067,271 probably benign Het
C130060K24Rik A T 6: 65,456,306 H370L probably benign Het
C1ql2 A G 1: 120,342,542 T278A probably damaging Het
Card14 A G 11: 119,338,406 H714R possibly damaging Het
Catsperd T C 17: 56,633,521 F69S probably damaging Het
Cep250 A G 2: 155,963,786 E105G probably damaging Het
Coil A G 11: 88,974,136 Y63C probably damaging Het
Cox14 A G 15: 99,727,678 probably null Het
D230025D16Rik T C 8: 105,238,472 probably benign Het
Defa24 T C 8: 21,734,601 I22T probably damaging Het
F5 T C 1: 164,217,490 Y2116H possibly damaging Het
Faf1 C T 4: 109,677,002 probably benign Het
Hectd4 A G 5: 121,298,104 S1026G probably benign Het
Hgf A T 5: 16,615,802 H649L probably benign Het
Hmces T C 6: 87,933,301 V231A probably damaging Het
Kcnh4 A G 11: 100,741,772 V963A probably benign Het
Ltbp1 T C 17: 75,385,201 probably null Het
Meox2 G A 12: 37,167,494 probably benign Het
Mis18bp1 A C 12: 65,149,339 S550R probably benign Het
Nav1 G T 1: 135,584,599 T241N probably damaging Het
Nbeal2 A G 9: 110,625,196 W2694R probably damaging Het
Olfr11 C A 13: 21,639,161 D121Y probably damaging Het
Olfr1263 A T 2: 90,015,511 I194F possibly damaging Het
Olfr744 A T 14: 50,619,122 H300L probably benign Het
Pld1 G A 3: 28,071,277 probably null Het
Podn T C 4: 108,017,858 R164G probably benign Het
R3hdm1 T A 1: 128,235,084 L966Q probably damaging Het
Rasef A T 4: 73,744,064 Y369* probably null Het
Ryr1 A T 7: 29,078,564 V2176E probably damaging Het
Sec14l2 A G 11: 4,103,980 L229P possibly damaging Het
Sec23a T C 12: 59,001,866 S157G possibly damaging Het
Slit2 T A 5: 48,189,472 W219R probably damaging Het
Smarcad1 G A 6: 65,056,416 E128K probably damaging Het
Stk31 A T 6: 49,423,384 N381I possibly damaging Het
Svop A G 5: 114,042,295 Y264H probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Ush2a T A 1: 188,874,869 I3987N probably damaging Het
Ush2a T A 1: 188,911,541 S4367T probably benign Het
Vdr A T 15: 97,867,171 V229D probably damaging Het
Ywhaz G T 15: 36,790,715 T88K possibly damaging Het
Zc3h10 A T 10: 128,544,803 C228* probably null Het
Other mutations in Nap1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Nap1l4 APN 7 143527316 splice site probably null
IGL02696:Nap1l4 APN 7 143524161 missense possibly damaging 0.67
IGL02710:Nap1l4 APN 7 143524261 missense probably benign 0.00
IGL03059:Nap1l4 APN 7 143527165 critical splice donor site probably null
IGL03164:Nap1l4 APN 7 143538216 critical splice donor site probably null
IGL03240:Nap1l4 APN 7 143538245 missense probably benign 0.00
Ballerina UTSW 7 143534463 splice site probably null
R1576:Nap1l4 UTSW 7 143538216 critical splice donor site probably null
R1967:Nap1l4 UTSW 7 143534287 missense probably damaging 0.99
R1989:Nap1l4 UTSW 7 143527184 missense probably damaging 0.99
R3734:Nap1l4 UTSW 7 143534395 splice site probably null
R4799:Nap1l4 UTSW 7 143534463 splice site probably null
R5367:Nap1l4 UTSW 7 143534298 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCTACAAGCCCTTCCAGTGCATC -3'
(R):5'- ACTTCAGGTCACATCAGGGCATTTC -3'

Sequencing Primer
(F):5'- TGACATGACTTCACCAAGGG -3'
(R):5'- GTCACATCAGGGCATTTCCATTTC -3'
Posted On2014-05-14