Mutagenetix > Incidental Mutation

Incidental Mutation 'R1705:Coil'

190028

Institutional Source

Beutler Lab

Gene Symbol

Coil

Ensembl Gene

ENSMUSG00000033983

Gene Name

coilin

Synonyms

Cln80, p80-coilin

MMRRC Submission

039738-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.165) question?

Stock #

R1705 (G1)

Quality Score

103

Status

Not validated

Chromosome

Chromosomal Location

88864761-88882439 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88864962 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 63 (Y63C)

Ref Sequence

ENSEMBL: ENSMUSP00000103530 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036649] [ENSMUST00000107898]

AlphaFold

Q5SU73

Predicted Effect

probably damaging
Transcript: ENSMUST00000036649
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047588
Gene: ENSMUSG00000033983
AA Change: Y63C

Domain	Start	End	E-Value	Type
low complexity region	54	70	N/A	INTRINSIC
low complexity region	161	167	N/A	INTRINSIC
low complexity region	174	195	N/A	INTRINSIC
low complexity region	300	322	N/A	INTRINSIC
low complexity region	401	417	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107898
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103530
Gene: ENSMUSG00000033983
AA Change: Y63C

Domain	Start	End	E-Value	Type
Pfam:Coilin_N	10	220	8.7e-35	PFAM
low complexity region	303	325	N/A	INTRINSIC
low complexity region	404	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122062

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

90% (43/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show reduced viability on inbred backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap8l	C	T	17: 32,551,457 (GRCm39)	R511H	probably damaging	Het
Apaf1	A	G	10: 90,903,133 (GRCm39)		probably benign	Het
C1ql2	A	G	1: 120,270,271 (GRCm39)	T278A	probably damaging	Het
Card14	A	G	11: 119,229,232 (GRCm39)	H714R	possibly damaging	Het
Catsperd	T	C	17: 56,940,521 (GRCm39)	F69S	probably damaging	Het
Cep250	A	G	2: 155,805,706 (GRCm39)	E105G	probably damaging	Het
Cox14	A	G	15: 99,625,559 (GRCm39)		probably null	Het
Defa24	T	C	8: 22,224,617 (GRCm39)	I22T	probably damaging	Het
F5	T	C	1: 164,045,059 (GRCm39)	Y2116H	possibly damaging	Het
Faf1	C	T	4: 109,534,199 (GRCm39)		probably benign	Het
Hectd4	A	G	5: 121,436,167 (GRCm39)	S1026G	probably benign	Het
Hgf	A	T	5: 16,820,800 (GRCm39)	H649L	probably benign	Het
Hmces	T	C	6: 87,910,283 (GRCm39)	V231A	probably damaging	Het
Kcnh4	A	G	11: 100,632,598 (GRCm39)	V963A	probably benign	Het
Ltbp1	T	C	17: 75,692,196 (GRCm39)		probably null	Het
Meox2	G	A	12: 37,217,493 (GRCm39)		probably benign	Het
Mis18bp1	A	C	12: 65,196,113 (GRCm39)	S550R	probably benign	Het
Nap1l4	A	T	7: 143,095,497 (GRCm39)	M1K	probably null	Het
Nav1	G	T	1: 135,512,337 (GRCm39)	T241N	probably damaging	Het
Nbeal2	A	G	9: 110,454,264 (GRCm39)	W2694R	probably damaging	Het
Or11g2	A	T	14: 50,856,579 (GRCm39)	H300L	probably benign	Het
Or2b6	C	A	13: 21,823,331 (GRCm39)	D121Y	probably damaging	Het
Or4c52	A	T	2: 89,845,855 (GRCm39)	I194F	possibly damaging	Het
Phaf1	T	C	8: 105,965,104 (GRCm39)		probably benign	Het
Pld1	G	A	3: 28,125,426 (GRCm39)		probably null	Het
Podn	T	C	4: 107,875,055 (GRCm39)	R164G	probably benign	Het
Qrfprl	A	T	6: 65,433,290 (GRCm39)	H370L	probably benign	Het
R3hdm1	T	A	1: 128,162,821 (GRCm39)	L966Q	probably damaging	Het
Rasef	A	T	4: 73,662,301 (GRCm39)	Y369*	probably null	Het
Ryr1	A	T	7: 28,777,989 (GRCm39)	V2176E	probably damaging	Het
Sec14l2	A	G	11: 4,053,980 (GRCm39)	L229P	possibly damaging	Het
Sec23a	T	C	12: 59,048,652 (GRCm39)	S157G	possibly damaging	Het
Slit2	T	A	5: 48,346,814 (GRCm39)	W219R	probably damaging	Het
Smarcad1	G	A	6: 65,033,400 (GRCm39)	E128K	probably damaging	Het
Stk31	A	T	6: 49,400,318 (GRCm39)	N381I	possibly damaging	Het
Svop	A	G	5: 114,180,356 (GRCm39)	Y264H	probably damaging	Het
Syt10	C	T	15: 89,674,979 (GRCm39)	D456N	probably damaging	Het
Ush2a	T	A	1: 188,607,066 (GRCm39)	I3987N	probably damaging	Het
Ush2a	T	A	1: 188,643,738 (GRCm39)	S4367T	probably benign	Het
Vdr	A	T	15: 97,765,052 (GRCm39)	V229D	probably damaging	Het
Ywhaz	G	T	15: 36,790,959 (GRCm39)	T88K	possibly damaging	Het
Zc3h10	A	T	10: 128,380,672 (GRCm39)	C228*	probably null	Het

Other mutations in Coil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02238:Coil	APN	11	88,872,580 (GRCm39)	missense	probably benign	0.02
PIT4519001:Coil	UTSW	11	88,863,552 (GRCm39)	start gained	probably benign
PIT4520001:Coil	UTSW	11	88,872,437 (GRCm39)	missense	probably benign	0.01
R0122:Coil	UTSW	11	88,875,833 (GRCm39)	splice site	probably benign
R0211:Coil	UTSW	11	88,872,979 (GRCm39)	missense	probably damaging	1.00
R0288:Coil	UTSW	11	88,872,694 (GRCm39)	missense	probably damaging	1.00
R0396:Coil	UTSW	11	88,872,449 (GRCm39)	missense	probably benign
R0416:Coil	UTSW	11	88,872,812 (GRCm39)	missense	possibly damaging	0.55
R1251:Coil	UTSW	11	88,873,125 (GRCm39)	missense	possibly damaging	0.93
R1481:Coil	UTSW	11	88,864,886 (GRCm39)	missense	possibly damaging	0.87
R1728:Coil	UTSW	11	88,864,802 (GRCm39)	missense	probably damaging	0.98
R1824:Coil	UTSW	11	88,872,923 (GRCm39)	missense	possibly damaging	0.91
R2989:Coil	UTSW	11	88,878,805 (GRCm39)	missense	probably damaging	1.00
R3819:Coil	UTSW	11	88,872,619 (GRCm39)	missense	probably benign	0.07
R5217:Coil	UTSW	11	88,871,987 (GRCm39)	missense	possibly damaging	0.94
R6997:Coil	UTSW	11	88,872,673 (GRCm39)	missense	probably benign
R7050:Coil	UTSW	11	88,872,014 (GRCm39)	missense	possibly damaging	0.87
R8504:Coil	UTSW	11	88,871,980 (GRCm39)	nonsense	probably null
R9564:Coil	UTSW	11	88,872,626 (GRCm39)	missense	possibly damaging	0.52
RF007:Coil	UTSW	11	88,872,656 (GRCm39)	small deletion	probably benign
Z1176:Coil	UTSW	11	88,872,802 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTACGGCTTCAATTTGACTACCC -3'
(R):5'- ATTTGCGCCATGCACACTGCAC -3'

Sequencing Primer
(F):5'- AATTTGACTACCCGCCGC -3'
(R):5'- GTTTAGTCCCCCTGAAATGAGAAG -3'

Posted On

2014-05-14