Incidental Mutation 'R1705:Sec23a'
ID190032
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
MMRRC Submission 039738-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R1705 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59001866 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 157 (S157G)
Ref Sequence ENSEMBL: ENSMUSP00000126011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021375
AA Change: S186G

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: S186G

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134223
Predicted Effect possibly damaging
Transcript: ENSMUST00000165134
AA Change: S157G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: S157G

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Meta Mutation Damage Score 0.2201 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 90% (43/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apaf1 A G 10: 91,067,271 probably benign Het
C130060K24Rik A T 6: 65,456,306 H370L probably benign Het
C1ql2 A G 1: 120,342,542 T278A probably damaging Het
Card14 A G 11: 119,338,406 H714R possibly damaging Het
Catsperd T C 17: 56,633,521 F69S probably damaging Het
Cep250 A G 2: 155,963,786 E105G probably damaging Het
Coil A G 11: 88,974,136 Y63C probably damaging Het
Cox14 A G 15: 99,727,678 probably null Het
D230025D16Rik T C 8: 105,238,472 probably benign Het
Defa24 T C 8: 21,734,601 I22T probably damaging Het
F5 T C 1: 164,217,490 Y2116H possibly damaging Het
Faf1 C T 4: 109,677,002 probably benign Het
Hectd4 A G 5: 121,298,104 S1026G probably benign Het
Hgf A T 5: 16,615,802 H649L probably benign Het
Hmces T C 6: 87,933,301 V231A probably damaging Het
Kcnh4 A G 11: 100,741,772 V963A probably benign Het
Ltbp1 T C 17: 75,385,201 probably null Het
Meox2 G A 12: 37,167,494 probably benign Het
Mis18bp1 A C 12: 65,149,339 S550R probably benign Het
Nap1l4 A T 7: 143,541,760 M1K probably null Het
Nav1 G T 1: 135,584,599 T241N probably damaging Het
Nbeal2 A G 9: 110,625,196 W2694R probably damaging Het
Olfr11 C A 13: 21,639,161 D121Y probably damaging Het
Olfr1263 A T 2: 90,015,511 I194F possibly damaging Het
Olfr744 A T 14: 50,619,122 H300L probably benign Het
Pld1 G A 3: 28,071,277 probably null Het
Podn T C 4: 108,017,858 R164G probably benign Het
R3hdm1 T A 1: 128,235,084 L966Q probably damaging Het
Rasef A T 4: 73,744,064 Y369* probably null Het
Ryr1 A T 7: 29,078,564 V2176E probably damaging Het
Sec14l2 A G 11: 4,103,980 L229P possibly damaging Het
Slit2 T A 5: 48,189,472 W219R probably damaging Het
Smarcad1 G A 6: 65,056,416 E128K probably damaging Het
Stk31 A T 6: 49,423,384 N381I possibly damaging Het
Svop A G 5: 114,042,295 Y264H probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Ush2a T A 1: 188,874,869 I3987N probably damaging Het
Ush2a T A 1: 188,911,541 S4367T probably benign Het
Vdr A T 15: 97,867,171 V229D probably damaging Het
Ywhaz G T 15: 36,790,715 T88K possibly damaging Het
Zc3h10 A T 10: 128,544,803 C228* probably null Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1084:Sec23a UTSW 12 58985135 missense probably damaging 0.97
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1997:Sec23a UTSW 12 59002007 missense probably benign
R2051:Sec23a UTSW 12 58990968 splice site probably null
R2081:Sec23a UTSW 12 58998281 nonsense probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R6716:Sec23a UTSW 12 58968823 missense probably benign 0.09
R7078:Sec23a UTSW 12 58992283 missense probably benign 0.07
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
R7923:Sec23a UTSW 12 58992247 missense probably damaging 0.99
R8178:Sec23a UTSW 12 59007194 missense possibly damaging 0.93
R8557:Sec23a UTSW 12 59005270 missense probably damaging 0.96
R8839:Sec23a UTSW 12 58990995 missense possibly damaging 0.79
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTATGGAGAGATACCCCAGACACAC -3'
(R):5'- TTTTACAGCGTGGTCCCCAGATG -3'

Sequencing Primer
(F):5'- TACCCCAGACACACTATGTTAAGTAG -3'
(R):5'- GGTCCCCAGATGCCTTTG -3'
Posted On2014-05-14