Incidental Mutation 'R1706:BC005624'
ID190047
Institutional Source Beutler Lab
Gene Symbol BC005624
Ensembl Gene ENSMUSG00000026851
Gene NamecDNA sequence BC005624
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R1706 (G1)
Quality Score220
Status Validated
Chromosome2
Chromosomal Location30972177-30982201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30978910 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000028205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028205] [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000138161] [ENSMUST00000142232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028205
AA Change: E84G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028205
Gene: ENSMUSG00000026851
AA Change: E84G

DomainStartEndE-ValueType
coiled coil region 10 37 N/A INTRINSIC
Pfam:Hep_59 101 197 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102849
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138161
SMART Domains Protein: ENSMUSP00000116696
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142232
SMART Domains Protein: ENSMUSP00000115347
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
PDB:2UZG|A 70 99 5e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192882
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in BC005624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:BC005624 APN 2 30978934 missense probably benign 0.37
IGL02350:BC005624 APN 2 30973767 missense probably benign 0.22
IGL02357:BC005624 APN 2 30973767 missense probably benign 0.22
IGL02887:BC005624 APN 2 30973305 splice site probably benign
R0401:BC005624 UTSW 2 30980009 missense probably benign 0.12
R0732:BC005624 UTSW 2 30973937 missense possibly damaging 0.87
R1629:BC005624 UTSW 2 30974008 missense probably damaging 1.00
R1712:BC005624 UTSW 2 30974008 missense probably damaging 1.00
R5840:BC005624 UTSW 2 30981857 missense probably benign 0.01
R5844:BC005624 UTSW 2 30976011 missense probably benign 0.02
R6932:BC005624 UTSW 2 30978928 missense possibly damaging 0.76
R7836:BC005624 UTSW 2 30974020 missense probably damaging 1.00
R8032:BC005624 UTSW 2 30975889 critical splice donor site probably null
R8333:BC005624 UTSW 2 30973736 missense probably benign 0.00
R8463:BC005624 UTSW 2 30981805 missense possibly damaging 0.80
R8488:BC005624 UTSW 2 30981845 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGTTACAGATACACGCTGTCCCAC -3'
(R):5'- GCACATACATGTTCATGCACACCAG -3'

Sequencing Primer
(F):5'- actcctaatccttctgtttccatc -3'
(R):5'- ACCAGCACACTCGATGATG -3'
Posted On2014-05-14