Incidental Mutation 'R1706:Olfr1099'
ID190048
Institutional Source Beutler Lab
Gene Symbol Olfr1099
Ensembl Gene ENSMUSG00000075168
Gene Nameolfactory receptor 1099
SynonymsMOR206-3, GA_x6K02T2Q125-48446067-48445129
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86955126-86960693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86959080 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 126 (I126N)
Ref Sequence ENSEMBL: ENSMUSP00000149528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099871] [ENSMUST00000213456]
Predicted Effect probably damaging
Transcript: ENSMUST00000099871
AA Change: I126N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097456
Gene: ENSMUSG00000075168
AA Change: I126N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.9e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213456
AA Change: I126N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4390 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Olfr1099
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Olfr1099 APN 2 86958921 missense possibly damaging 0.90
IGL01624:Olfr1099 APN 2 86959230 missense probably benign 0.05
IGL02119:Olfr1099 APN 2 86959183 missense probably benign 0.24
IGL02433:Olfr1099 APN 2 86959048 missense possibly damaging 0.63
IGL02646:Olfr1099 APN 2 86959353 missense probably damaging 1.00
IGL02824:Olfr1099 APN 2 86958993 missense probably benign 0.03
IGL03228:Olfr1099 APN 2 86958706 missense probably benign 0.16
R0208:Olfr1099 UTSW 2 86959404 missense probably damaging 0.96
R0521:Olfr1099 UTSW 2 86958846 missense probably damaging 1.00
R0783:Olfr1099 UTSW 2 86958562 missense probably benign
R1859:Olfr1099 UTSW 2 86959081 missense probably damaging 0.99
R2046:Olfr1099 UTSW 2 86958733 missense possibly damaging 0.75
R2126:Olfr1099 UTSW 2 86959098 missense possibly damaging 0.63
R2140:Olfr1099 UTSW 2 86959281 missense probably damaging 1.00
R4452:Olfr1099 UTSW 2 86958699 missense probably damaging 0.99
R4680:Olfr1099 UTSW 2 86959321 missense possibly damaging 0.87
R4958:Olfr1099 UTSW 2 86959105 missense possibly damaging 0.75
R4970:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5112:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5532:Olfr1099 UTSW 2 86958580 nonsense probably null
R5691:Olfr1099 UTSW 2 86959272 missense probably damaging 1.00
R6851:Olfr1099 UTSW 2 86959267 missense possibly damaging 0.46
R6858:Olfr1099 UTSW 2 86958690 missense probably benign 0.11
R7368:Olfr1099 UTSW 2 86959258 missense probably damaging 1.00
Z1088:Olfr1099 UTSW 2 86958666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTAACTGCCAGGATATGAGAGGCAC -3'
(R):5'- CTGACAGATTCCAAGGAGGTTCAGC -3'

Sequencing Primer
(F):5'- GTGGAACTGATCTTCAAAATGGTAG -3'
(R):5'- AGGCATGATACTGATCATCCGTC -3'
Posted On2014-05-14