Incidental Mutation 'R1706:Tgm6'
ID190052
Institutional Source Beutler Lab
Gene Symbol Tgm6
Ensembl Gene ENSMUSG00000027403
Gene Nametransglutaminase 6
SynonymsTGM3L
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130112416-130154232 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130145159 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 516 (C516R)
Ref Sequence ENSEMBL: ENSMUSP00000028888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028888
AA Change: C516R

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028888
Gene: ENSMUSG00000027403
AA Change: C516R

DomainStartEndE-ValueType
Pfam:Transglut_N 5 119 3e-31 PFAM
TGc 266 359 3.48e-40 SMART
low complexity region 466 483 N/A INTRINSIC
Pfam:Transglut_C 495 600 2.4e-23 PFAM
Pfam:Transglut_C 607 704 4.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147616
Meta Mutation Damage Score 0.0930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the transglutaminase superfamily. It catalyzes the cross-linking of proteins and the conjugation of polyamines to proteins. Mutations in this gene are associated with spinocerebellar ataxia type 35 (SCA35). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Tgm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Tgm6 APN 2 130136495 missense probably benign 0.00
IGL01331:Tgm6 APN 2 130143618 splice site probably null
IGL01348:Tgm6 APN 2 130137379 missense probably damaging 1.00
IGL01787:Tgm6 APN 2 130151434 splice site probably benign
IGL02208:Tgm6 APN 2 130135870 missense probably benign 0.11
IGL02656:Tgm6 APN 2 130145103 missense probably damaging 1.00
IGL03280:Tgm6 APN 2 130138931 missense probably damaging 1.00
R0200:Tgm6 UTSW 2 130152945 splice site probably null
R0507:Tgm6 UTSW 2 130138831 missense possibly damaging 0.56
R0744:Tgm6 UTSW 2 130151761 missense probably benign 0.00
R0800:Tgm6 UTSW 2 130143422 missense possibly damaging 0.94
R1530:Tgm6 UTSW 2 130151282 missense possibly damaging 0.71
R1573:Tgm6 UTSW 2 130151740 missense probably benign 0.00
R2330:Tgm6 UTSW 2 130143242 missense probably damaging 1.00
R2881:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R2882:Tgm6 UTSW 2 130137439 missense probably benign 0.04
R3622:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R3624:Tgm6 UTSW 2 130151761 missense possibly damaging 0.86
R4370:Tgm6 UTSW 2 130143605 missense probably benign 0.12
R4664:Tgm6 UTSW 2 130137394 missense probably benign 0.05
R4664:Tgm6 UTSW 2 130141208 missense probably benign 0.34
R4983:Tgm6 UTSW 2 130141193 missense probably damaging 0.99
R5182:Tgm6 UTSW 2 130141302 missense probably damaging 0.98
R5397:Tgm6 UTSW 2 130141908 missense possibly damaging 0.90
R5411:Tgm6 UTSW 2 130145196 missense probably benign 0.01
R5683:Tgm6 UTSW 2 130138955 missense probably damaging 1.00
R5933:Tgm6 UTSW 2 130141256 missense probably damaging 1.00
R6016:Tgm6 UTSW 2 130141228 missense probably damaging 0.99
R7252:Tgm6 UTSW 2 130144964 missense probably damaging 1.00
R7290:Tgm6 UTSW 2 130141190 missense probably damaging 1.00
R7581:Tgm6 UTSW 2 130141285 missense probably damaging 1.00
R8143:Tgm6 UTSW 2 130141843 missense probably damaging 0.98
R8153:Tgm6 UTSW 2 130145055 missense probably benign 0.00
R8219:Tgm6 UTSW 2 130151280 missense probably benign
R8297:Tgm6 UTSW 2 130137438 missense probably benign
R8743:Tgm6 UTSW 2 130143498 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAAACTGCTAAGTGTGGAAGCCTG -3'
(R):5'- CGAGTGGCAAGCACTGACCATAAAG -3'

Sequencing Primer
(F):5'- TGTGGAAGCCTGGGGGAG -3'
(R):5'- CTGACCATAAAGCTTAGGGCTG -3'
Posted On2014-05-14