Incidental Mutation 'R1706:Pygb'
ID190054
Institutional Source Beutler Lab
Gene Symbol Pygb
Ensembl Gene ENSMUSG00000033059
Gene Namebrain glycogen phosphorylase
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150786735-150831758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150827147 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 671 (G671D)
Ref Sequence ENSEMBL: ENSMUSP00000035743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441]
Predicted Effect probably damaging
Transcript: ENSMUST00000045441
AA Change: G671D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059
AA Change: G671D

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135717
Meta Mutation Damage Score 0.9575 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen phosphorylase found predominantly in the brain. The encoded protein forms homodimers which can associate into homotetramers, the enzymatically active form of glycogen phosphorylase. The activity of this enzyme is positively regulated by AMP and negatively regulated by ATP, ADP, and glucose-6-phosphate. This enzyme catalyzes the rate-determining step in glycogen degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Pygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Pygb APN 2 150819913 missense probably benign 0.00
IGL01395:Pygb APN 2 150801583 missense probably benign 0.04
IGL01571:Pygb APN 2 150830473 missense probably benign 0.00
IGL01960:Pygb APN 2 150813483 missense probably benign 0.00
IGL03118:Pygb APN 2 150820811 missense probably benign 0.01
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0423:Pygb UTSW 2 150823984 missense probably benign
R0545:Pygb UTSW 2 150815706 missense probably benign 0.00
R0674:Pygb UTSW 2 150815134 splice site probably null
R1052:Pygb UTSW 2 150786938 missense probably benign 0.00
R1590:Pygb UTSW 2 150817663 missense possibly damaging 0.94
R1786:Pygb UTSW 2 150816772 missense probably damaging 0.98
R2405:Pygb UTSW 2 150820775 missense probably benign 0.04
R3522:Pygb UTSW 2 150828553 missense probably benign 0.07
R4082:Pygb UTSW 2 150826471 critical splice donor site probably null
R4319:Pygb UTSW 2 150815614 splice site probably benign
R4662:Pygb UTSW 2 150815116 missense probably benign
R5072:Pygb UTSW 2 150801578 missense probably damaging 1.00
R5665:Pygb UTSW 2 150820888 splice site probably null
R5874:Pygb UTSW 2 150786878 missense probably benign 0.11
R5910:Pygb UTSW 2 150815700 missense probably benign 0.00
R6610:Pygb UTSW 2 150823966 splice site probably null
R6820:Pygb UTSW 2 150816754 missense possibly damaging 0.88
R7348:Pygb UTSW 2 150786983 missense probably benign 0.10
R7920:Pygb UTSW 2 150787002 missense possibly damaging 0.92
R7936:Pygb UTSW 2 150815669 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GATGTCCCTGAACCTTCCTTGAACC -3'
(R):5'- TCAATGAGTACTGAGTCCCTGACCC -3'

Sequencing Primer
(F):5'- ccccctctctccctcttc -3'
(R):5'- GAGTCCCTGACCCATGTCAC -3'
Posted On2014-05-14