Incidental Mutation 'R1706:Gnas'
ID190055
Institutional Source Beutler Lab
Gene Symbol Gnas
Ensembl Gene ENSMUSG00000027523
Gene NameGNAS (guanine nucleotide binding protein, alpha stimulating) complex locus
SynonymsGnasxl, C130027O20Rik, 5530400H20Rik, Nespl, Nesp, A930027G11Rik, Gs alpha, G alpha s, Gsa, Nesp55, Galphas, Gnas1, P1, Gs-alpha, XLalphas, P3, neuroendocrine-specific Golgi protein p55 isoform 1, Oedsml, P2
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1706 (G1)
Quality Score203
Status Validated
Chromosome2
Chromosomal Location174284320-174346744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174299975 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 646 (S646T)
Ref Sequence ENSEMBL: ENSMUSP00000139839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080493] [ENSMUST00000087876] [ENSMUST00000087877] [ENSMUST00000109088] [ENSMUST00000109095] [ENSMUST00000109096] [ENSMUST00000130761] [ENSMUST00000130940] [ENSMUST00000180362] [ENSMUST00000186907] [ENSMUST00000185956]
Predicted Effect probably benign
Transcript: ENSMUST00000080493
AA Change: V705D

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079341
Gene: ENSMUSG00000027523
AA Change: V705D

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087876
AA Change: V705D

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085184
Gene: ENSMUSG00000027523
AA Change: V705D

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 2.42e-8 PROSPERO
internal_repeat_1 209 276 2.42e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1118 8.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087877
AA Change: V705D

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085185
Gene: ENSMUSG00000027523
AA Change: V705D

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 1.1e-8 PROSPERO
internal_repeat_1 209 276 1.1e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
Blast:G_alpha 759 799 2e-14 BLAST
low complexity region 802 816 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109088
AA Change: S646T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104716
Gene: ENSMUSG00000027523
AA Change: S646T

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109095
SMART Domains Protein: ENSMUSP00000104723
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109096
SMART Domains Protein: ENSMUSP00000104724
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130761
Predicted Effect probably benign
Transcript: ENSMUST00000130940
SMART Domains Protein: ENSMUSP00000118210
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 59 1.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154658
Predicted Effect probably benign
Transcript: ENSMUST00000180362
SMART Domains Protein: ENSMUSP00000136180
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183673
Predicted Effect possibly damaging
Transcript: ENSMUST00000186907
AA Change: S646T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139839
Gene: ENSMUSG00000027523
AA Change: S646T

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185956
AA Change: V705D

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140174
Gene: ENSMUSG00000027523
AA Change: V705D

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184327
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mutant homozygotes stop developing normally by embryonic day 10.5 and die prenatally. On some backgrounds heterozygotes show imprinted phenotypes, including differences in body shape/weight, locomotor activity, metabolism, and developmental anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Gnas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gnas APN 2 174341711 splice site probably benign
IGL00928:Gnas APN 2 174297953 nonsense probably null
IGL01014:Gnas APN 2 174297974 utr 5 prime probably benign
IGL01743:Gnas APN 2 174298332 nonsense probably null
IGL01808:Gnas APN 2 174298697 missense probably damaging 0.96
IGL02559:Gnas APN 2 174341936 splice site probably benign
R0555:Gnas UTSW 2 174298511 missense possibly damaging 0.78
R0627:Gnas UTSW 2 174298135 intron probably benign
R1418:Gnas UTSW 2 174345214 splice site probably benign
R1751:Gnas UTSW 2 174297894 utr 5 prime probably benign
R1968:Gnas UTSW 2 174298733 missense probably damaging 0.96
R2290:Gnas UTSW 2 174300010 missense probably benign 0.09
R4125:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4128:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4697:Gnas UTSW 2 174298080 missense probably damaging 1.00
R4888:Gnas UTSW 2 174298089 missense possibly damaging 0.94
R5458:Gnas UTSW 2 174298331 missense probably benign 0.41
R5640:Gnas UTSW 2 174284971 missense probably benign 0.44
R5696:Gnas UTSW 2 174299675 intron probably benign
R5757:Gnas UTSW 2 174345247 missense probably damaging 1.00
R6053:Gnas UTSW 2 174299852 missense possibly damaging 0.89
R6083:Gnas UTSW 2 174297862 start codon destroyed probably null
R6736:Gnas UTSW 2 174334251 missense probably damaging 0.98
R7074:Gnas UTSW 2 174285049 missense probably damaging 1.00
R7239:Gnas UTSW 2 174298615 missense unknown
R7541:Gnas UTSW 2 174298099 missense unknown
R7679:Gnas UTSW 2 174284831 missense probably damaging 0.99
R7694:Gnas UTSW 2 174300212 missense probably damaging 1.00
R7713:Gnas UTSW 2 174299027 missense unknown
R7834:Gnas UTSW 2 174298990 nonsense probably null
R8138:Gnas UTSW 2 174298386 missense probably benign 0.06
R8459:Gnas UTSW 2 174284939 missense probably benign 0.05
R8537:Gnas UTSW 2 174298601 missense possibly damaging 0.83
R8731:Gnas UTSW 2 174284906 missense probably benign 0.01
R8924:Gnas UTSW 2 174299484 missense unknown
X0022:Gnas UTSW 2 174299744 missense probably benign 0.33
Z1088:Gnas UTSW 2 174298373 missense probably benign 0.27
Z1176:Gnas UTSW 2 174298606 missense unknown
Z1177:Gnas UTSW 2 174284887 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTGGCCTGACAAGTACGAG -3'
(R):5'- CAGAAGCTGCCGCATTACCTAGAAG -3'

Sequencing Primer
(F):5'- CTGACAAGTACGAGCGGGG -3'
(R):5'- TTACCTAGAAGCAGCAGGC -3'
Posted On2014-05-14