Incidental Mutation 'R1706:Vmn2r7'
ID190056
Institutional Source Beutler Lab
Gene Symbol Vmn2r7
Ensembl Gene ENSMUSG00000116028
Gene Name
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64690660-64719602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64691459 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 559 (H559L)
Ref Sequence ENSEMBL: ENSMUSP00000131220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161972] [ENSMUST00000168072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000161972
AA Change: H650L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124192
Gene: ENSMUSG00000062200
AA Change: H650L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 90 507 3.8e-77 PFAM
Pfam:NCD3G 549 602 3.4e-17 PFAM
Pfam:7tm_3 635 869 1.1e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168072
AA Change: H559L

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131220
Gene: ENSMUSG00000116028
AA Change: H559L

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 5.1e-72 PFAM
Pfam:Peripla_BP_6 63 245 6.1e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 4.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177146
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Vmn2r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Vmn2r7 APN 3 64715813 missense possibly damaging 0.60
IGL01762:Vmn2r7 APN 3 64691435 missense probably benign 0.39
IGL01903:Vmn2r7 APN 3 64719443 missense probably benign 0.00
IGL02263:Vmn2r7 APN 3 64691447 missense probably damaging 1.00
IGL02458:Vmn2r7 APN 3 64693025 missense probably damaging 0.97
IGL02593:Vmn2r7 APN 3 64693022 missense probably damaging 1.00
IGL02797:Vmn2r7 APN 3 64691245 missense possibly damaging 0.80
IGL03047:Vmn2r7 UTSW 3 64707218 missense possibly damaging 0.81
PIT4504001:Vmn2r7 UTSW 3 64715976 missense probably benign 0.01
R0193:Vmn2r7 UTSW 3 64691039 missense probably damaging 1.00
R0329:Vmn2r7 UTSW 3 64691018 missense probably damaging 1.00
R0609:Vmn2r7 UTSW 3 64716479 missense probably benign 0.44
R0735:Vmn2r7 UTSW 3 64716367 missense probably benign 0.02
R0941:Vmn2r7 UTSW 3 64716579 missense probably benign
R1065:Vmn2r7 UTSW 3 64707138 missense possibly damaging 0.82
R1378:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R1445:Vmn2r7 UTSW 3 64724802 missense probably benign 0.01
R1506:Vmn2r7 UTSW 3 64707079 missense probably benign
R1509:Vmn2r7 UTSW 3 64716460 nonsense probably null
R1519:Vmn2r7 UTSW 3 64716455 missense possibly damaging 0.95
R2113:Vmn2r7 UTSW 3 64691604 missense possibly damaging 0.59
R3725:Vmn2r7 UTSW 3 64724991 missense possibly damaging 0.65
R3874:Vmn2r7 UTSW 3 64719611 missense possibly damaging 0.69
R3902:Vmn2r7 UTSW 3 64719516 missense possibly damaging 0.46
R4084:Vmn2r7 UTSW 3 64692993 missense probably benign 0.08
R4117:Vmn2r7 UTSW 3 64715717 intron probably benign
R4333:Vmn2r7 UTSW 3 64690778 missense probably damaging 1.00
R4551:Vmn2r7 UTSW 3 64690689 missense possibly damaging 0.86
R4643:Vmn2r7 UTSW 3 64716404 missense probably damaging 1.00
R4654:Vmn2r7 UTSW 3 64719443 missense probably benign 0.00
R5091:Vmn2r7 UTSW 3 64690784 missense possibly damaging 0.63
R5109:Vmn2r7 UTSW 3 64690667 missense probably null 0.84
R5372:Vmn2r7 UTSW 3 64716324 missense probably damaging 1.00
R5415:Vmn2r7 UTSW 3 64716237 missense probably benign 0.07
R5740:Vmn2r7 UTSW 3 64707233 missense probably benign
R5977:Vmn2r7 UTSW 3 64716043 nonsense probably null
R6019:Vmn2r7 UTSW 3 64716222 missense probably damaging 1.00
R6058:Vmn2r7 UTSW 3 64725015 missense probably benign 0.00
R6139:Vmn2r7 UTSW 3 64715918 missense probably damaging 1.00
R6696:Vmn2r7 UTSW 3 64707074 missense probably benign 0.01
R6887:Vmn2r7 UTSW 3 64690827 missense probably damaging 1.00
R6918:Vmn2r7 UTSW 3 64691339 missense probably benign 0.03
R6949:Vmn2r7 UTSW 3 64691121 missense probably damaging 0.99
R6980:Vmn2r7 UTSW 3 64716566 missense possibly damaging 0.67
R7196:Vmn2r7 UTSW 3 64715777 missense probably benign 0.00
R7286:Vmn2r7 UTSW 3 64690880 missense probably benign 0.00
R7455:Vmn2r7 UTSW 3 64716593 missense probably benign
R7557:Vmn2r7 UTSW 3 64724973 missense probably benign
R7864:Vmn2r7 UTSW 3 64691526 missense probably benign 0.10
R8046:Vmn2r7 UTSW 3 64707058 missense probably damaging 1.00
R8068:Vmn2r7 UTSW 3 64716086 missense probably benign 0.01
R8252:Vmn2r7 UTSW 3 64693106 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGGCTCCAACACCAAGTAAGCTG -3'
(R):5'- TGTCACATCATCTGCACCAAGGC -3'

Sequencing Primer
(F):5'- GCCGAGTTTTAGATATGGACATCC -3'
(R):5'- ataGATTTCCAGTAAATCCTGTTGAG -3'
Posted On2014-05-14