Incidental Mutation 'R1706:Zzz3'
ID190057
Institutional Source Beutler Lab
Gene Symbol Zzz3
Ensembl Gene ENSMUSG00000039068
Gene Namezinc finger, ZZ domain containing 3
Synonyms3110065C23Rik, 6430567E01Rik
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152395473-152462826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152449098 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 633 (D633E)
Ref Sequence ENSEMBL: ENSMUSP00000101707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089982] [ENSMUST00000106100] [ENSMUST00000106101] [ENSMUST00000106103] [ENSMUST00000200570]
Predicted Effect probably damaging
Transcript: ENSMUST00000089982
AA Change: D632E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087428
Gene: ENSMUSG00000039068
AA Change: D632E

DomainStartEndE-ValueType
SANT 657 711 1.42e-9 SMART
low complexity region 776 787 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
ZnF_ZZ 823 871 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106100
AA Change: D633E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101706
Gene: ENSMUSG00000039068
AA Change: D633E

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106101
AA Change: D633E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101707
Gene: ENSMUSG00000039068
AA Change: D633E

DomainStartEndE-ValueType
SANT 658 712 1.42e-9 SMART
low complexity region 777 788 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
ZnF_ZZ 824 872 6.46e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106103
AA Change: D132E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101709
Gene: ENSMUSG00000039068
AA Change: D132E

DomainStartEndE-ValueType
SANT 157 211 1.42e-9 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
ZnF_ZZ 323 371 6.46e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197987
Predicted Effect possibly damaging
Transcript: ENSMUST00000200570
AA Change: D136E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143693
Gene: ENSMUSG00000039068
AA Change: D136E

DomainStartEndE-ValueType
SANT 161 215 1.42e-9 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
ZnF_ZZ 327 375 6.46e-3 SMART
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Other mutations in Zzz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Zzz3 APN 3 152428514 missense probably benign 0.16
IGL00707:Zzz3 APN 3 152449043 nonsense probably null
IGL00983:Zzz3 APN 3 152455810 splice site probably benign
IGL01586:Zzz3 APN 3 152455839 missense possibly damaging 0.80
IGL01973:Zzz3 APN 3 152428370 missense probably benign 0.00
IGL02002:Zzz3 APN 3 152451369 missense probably damaging 0.98
IGL02009:Zzz3 APN 3 152428115 missense possibly damaging 0.80
IGL02260:Zzz3 APN 3 152452083 missense probably benign 0.04
IGL02336:Zzz3 APN 3 152428059 missense possibly damaging 0.74
IGL02454:Zzz3 APN 3 152428574 missense probably benign 0.03
IGL02519:Zzz3 APN 3 152427390 missense probably damaging 1.00
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0067:Zzz3 UTSW 3 152428403 missense possibly damaging 0.88
R0314:Zzz3 UTSW 3 152427448 missense probably benign 0.00
R0536:Zzz3 UTSW 3 152448828 missense probably damaging 1.00
R2869:Zzz3 UTSW 3 152446844 synonymous silent
R2870:Zzz3 UTSW 3 152446844 synonymous silent
R2871:Zzz3 UTSW 3 152446844 synonymous silent
R2872:Zzz3 UTSW 3 152446844 synonymous silent
R3927:Zzz3 UTSW 3 152455862 missense probably damaging 1.00
R4195:Zzz3 UTSW 3 152428465 missense probably benign 0.02
R4768:Zzz3 UTSW 3 152448783 missense probably damaging 1.00
R5248:Zzz3 UTSW 3 152427545 missense probably damaging 0.99
R5566:Zzz3 UTSW 3 152455824 missense probably damaging 1.00
R5752:Zzz3 UTSW 3 152452122 missense possibly damaging 0.48
R5782:Zzz3 UTSW 3 152428100 missense possibly damaging 0.69
R5884:Zzz3 UTSW 3 152450658 missense probably damaging 1.00
R6008:Zzz3 UTSW 3 152428151 missense probably benign 0.01
R6155:Zzz3 UTSW 3 152427682 missense possibly damaging 0.57
R6557:Zzz3 UTSW 3 152428460 missense probably damaging 1.00
R6865:Zzz3 UTSW 3 152428053 missense probably benign 0.01
R7344:Zzz3 UTSW 3 152452099 missense probably damaging 0.98
R7588:Zzz3 UTSW 3 152422768 missense possibly damaging 0.85
R7636:Zzz3 UTSW 3 152427652 missense probably benign
R7732:Zzz3 UTSW 3 152448842 missense probably damaging 1.00
R8157:Zzz3 UTSW 3 152449648 missense probably null 0.71
R8490:Zzz3 UTSW 3 152428653 nonsense probably null
R8926:Zzz3 UTSW 3 152427892 missense possibly damaging 0.76
X0018:Zzz3 UTSW 3 152428733 missense possibly damaging 0.88
Z1176:Zzz3 UTSW 3 152449097 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAGTACACCAATAGCCTTGGGAAC -3'
(R):5'- GGCCACATCTGAAATCCTGGTCAC -3'

Sequencing Primer
(F):5'- TTTGATAAAGGTAAGAACCCACACG -3'
(R):5'- GAAATCCTGGTCACACTTTATAGTGC -3'
Posted On2014-05-14