Incidental Mutation 'R1706:Tex10'
Institutional Source Beutler Lab
Gene Symbol Tex10
Ensembl Gene ENSMUSG00000028345
Gene Nametestis expressed gene 10
Synonymsclone 18330, 2810462N03Rik, 2610206N19Rik
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosomal Location48430858-48473459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48456800 bp
Amino Acid Change Arginine to Glutamine at position 637 (R637Q)
Ref Sequence ENSEMBL: ENSMUSP00000132498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030030] [ENSMUST00000155905] [ENSMUST00000164866]
Predicted Effect probably benign
Transcript: ENSMUST00000030030
AA Change: R637Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030030
Gene: ENSMUSG00000028345
AA Change: R637Q

low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 130 235 9.7e-24 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138531
Predicted Effect probably benign
Transcript: ENSMUST00000155905
SMART Domains Protein: ENSMUSP00000114669
Gene: ENSMUSG00000028345

Pfam:Ipi1_N 47 152 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164866
AA Change: R637Q

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132498
Gene: ENSMUSG00000028345
AA Change: R637Q

low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 132 235 4.1e-25 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E7.5 with impaired inner cell mass proliferation in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Tex10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tex10 APN 4 48469937 nonsense probably null
IGL00832:Tex10 APN 4 48468864 missense probably benign
IGL01376:Tex10 APN 4 48456740 missense possibly damaging 0.90
IGL01594:Tex10 APN 4 48469906 missense possibly damaging 0.47
IGL02754:Tex10 APN 4 48435028 missense possibly damaging 0.46
IGL03071:Tex10 APN 4 48452946 missense probably benign 0.00
IGL03399:Tex10 APN 4 48459915 missense probably benign 0.04
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0544:Tex10 UTSW 4 48462766 splice site probably null
R0583:Tex10 UTSW 4 48451952 missense probably damaging 1.00
R0591:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0592:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0593:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0893:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1485:Tex10 UTSW 4 48436492 missense possibly damaging 0.54
R1703:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1704:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1911:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1912:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1930:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1983:Tex10 UTSW 4 48460059 missense possibly damaging 0.93
R2001:Tex10 UTSW 4 48451940 missense probably damaging 1.00
R2074:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2075:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2157:Tex10 UTSW 4 48436522 splice site probably benign
R3000:Tex10 UTSW 4 48459393 splice site probably null
R4067:Tex10 UTSW 4 48459355 nonsense probably null
R4081:Tex10 UTSW 4 48468873 missense probably benign 0.11
R4133:Tex10 UTSW 4 48468968 missense probably damaging 1.00
R4352:Tex10 UTSW 4 48452039 missense possibly damaging 0.77
R4364:Tex10 UTSW 4 48468774 missense probably benign 0.13
R4601:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4602:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4610:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4707:Tex10 UTSW 4 48468984 missense probably benign 0.00
R4744:Tex10 UTSW 4 48469990 missense probably benign 0.00
R4778:Tex10 UTSW 4 48436468 missense probably damaging 1.00
R4989:Tex10 UTSW 4 48458525 splice site probably benign
R5051:Tex10 UTSW 4 48460019 missense possibly damaging 0.86
R5120:Tex10 UTSW 4 48459272 missense possibly damaging 0.68
R5732:Tex10 UTSW 4 48460046 missense probably damaging 1.00
R5799:Tex10 UTSW 4 48433295 missense possibly damaging 0.62
R5813:Tex10 UTSW 4 48452928 missense probably benign 0.00
R6091:Tex10 UTSW 4 48459891 missense probably damaging 0.98
R6223:Tex10 UTSW 4 48468525 missense probably damaging 0.98
R6493:Tex10 UTSW 4 48436450 missense probably damaging 1.00
R7567:Tex10 UTSW 4 48468787 missense possibly damaging 0.93
R7590:Tex10 UTSW 4 48467725 missense probably damaging 0.99
R7808:Tex10 UTSW 4 48459984 missense probably benign
R8004:Tex10 UTSW 4 48452047 missense possibly damaging 0.64
R8084:Tex10 UTSW 4 48431066 missense probably benign 0.05
X0017:Tex10 UTSW 4 48460080 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccagtatgatctacattgtaagttcc -3'
(R):5'- tcagaaatccgcctgcc -3'
Posted On2014-05-14