Incidental Mutation 'R1706:Clcn6'
ID190064
Institutional Source Beutler Lab
Gene Symbol Clcn6
Ensembl Gene ENSMUSG00000029016
Gene Namechloride channel, voltage-sensitive 6
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148004259-148038821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 148017568 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 353 (T353I)
Ref Sequence ENSEMBL: ENSMUSP00000121751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030879] [ENSMUST00000105711] [ENSMUST00000137724]
Predicted Effect probably benign
Transcript: ENSMUST00000030879
AA Change: T350I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030879
Gene: ENSMUSG00000029016
AA Change: T350I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 138 571 5.5e-98 PFAM
CBS 609 658 1.68e-3 SMART
CBS 811 859 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105711
AA Change: T353I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101336
Gene: ENSMUSG00000029016
AA Change: T353I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.5e-98 PFAM
CBS 612 661 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137724
AA Change: T353I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121751
Gene: ENSMUSG00000029016
AA Change: T353I

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Voltage_CLC 141 574 1.9e-101 PFAM
CBS 612 661 1.68e-3 SMART
CBS 814 862 1.34e-11 SMART
Meta Mutation Damage Score 0.2048 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a member of the ClC chloride channel and transporter family of proteins. The encoded protein may function as a vesicular Cl-/H+ antiporter. Homozygous knockout mice exhibit decreased pain sensitivity, behavioral abnormalities and features of lysosomal storage disease. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired nociception, mild behavioral abnormalities, and a progressive neuropathy of the central and peripheral nervous systems with features of neuronal ceroid lipofuscinosis (a lysosomal storage disease). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Clcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Clcn6 APN 4 148017902 critical splice donor site probably null
IGL00434:Clcn6 APN 4 148013738 missense probably damaging 1.00
IGL00973:Clcn6 APN 4 148013788 splice site probably benign
IGL01384:Clcn6 APN 4 148018966 missense probably damaging 1.00
IGL01465:Clcn6 APN 4 148021451 splice site probably benign
IGL01522:Clcn6 APN 4 148017535 missense probably benign 0.44
R0194:Clcn6 UTSW 4 148012756 missense probably damaging 1.00
R0280:Clcn6 UTSW 4 148008715 missense probably damaging 1.00
R0349:Clcn6 UTSW 4 148024194 missense possibly damaging 0.89
R0352:Clcn6 UTSW 4 148014606 missense probably damaging 1.00
R0586:Clcn6 UTSW 4 148038749 unclassified probably benign
R0927:Clcn6 UTSW 4 148029392 missense probably benign 0.30
R1141:Clcn6 UTSW 4 148013899 missense probably damaging 0.99
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1465:Clcn6 UTSW 4 148013901 missense probably damaging 1.00
R1473:Clcn6 UTSW 4 148024156 missense possibly damaging 0.93
R1551:Clcn6 UTSW 4 148012778 missense possibly damaging 0.74
R1571:Clcn6 UTSW 4 148012769 missense possibly damaging 0.63
R1593:Clcn6 UTSW 4 148014594 missense probably benign
R1596:Clcn6 UTSW 4 148023379 missense probably damaging 1.00
R1769:Clcn6 UTSW 4 148014301 splice site probably null
R2021:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2022:Clcn6 UTSW 4 148010652 critical splice donor site probably null
R2049:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2081:Clcn6 UTSW 4 148011068 missense probably damaging 1.00
R2140:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2141:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2142:Clcn6 UTSW 4 148024137 missense possibly damaging 0.88
R2177:Clcn6 UTSW 4 148014600 missense possibly damaging 0.73
R2511:Clcn6 UTSW 4 148017494 critical splice donor site probably null
R2891:Clcn6 UTSW 4 148012616 critical splice donor site probably null
R3750:Clcn6 UTSW 4 148024187 nonsense probably null
R4014:Clcn6 UTSW 4 148017610 missense probably damaging 0.98
R4023:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4024:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4025:Clcn6 UTSW 4 148014283 missense possibly damaging 0.91
R4667:Clcn6 UTSW 4 148024167 missense possibly damaging 0.61
R4865:Clcn6 UTSW 4 148019766 missense probably damaging 1.00
R4978:Clcn6 UTSW 4 148008770 missense probably benign 0.05
R5140:Clcn6 UTSW 4 148038317 unclassified probably benign
R5345:Clcn6 UTSW 4 148038749 unclassified probably benign
R5467:Clcn6 UTSW 4 148017636 missense possibly damaging 0.81
R5665:Clcn6 UTSW 4 148014561 missense possibly damaging 0.71
R5739:Clcn6 UTSW 4 148014189 missense probably damaging 1.00
R5899:Clcn6 UTSW 4 148017592 missense probably benign 0.01
R6043:Clcn6 UTSW 4 148008788 missense probably damaging 1.00
R6351:Clcn6 UTSW 4 148017500 missense probably benign 0.01
R6593:Clcn6 UTSW 4 148010769 missense probably benign 0.21
R7440:Clcn6 UTSW 4 148014195 missense probably damaging 1.00
R7674:Clcn6 UTSW 4 148012694 missense probably damaging 1.00
R7756:Clcn6 UTSW 4 148029439 missense probably damaging 1.00
R7901:Clcn6 UTSW 4 148010745 missense probably damaging 1.00
R8559:Clcn6 UTSW 4 148026575 missense possibly damaging 0.88
R8747:Clcn6 UTSW 4 148008897 critical splice donor site probably null
V7732:Clcn6 UTSW 4 148013955 missense probably damaging 0.96
Z1177:Clcn6 UTSW 4 148023370 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGTCATGTGTGTCAGCAGAAGAG -3'
(R):5'- TCTTAAAAGCCCAGTGGGACAAGTG -3'

Sequencing Primer
(F):5'- TACAGGCTTAGTCTCAGGAGAAATC -3'
(R):5'- GGAAGGCAAGCATCTGCTC -3'
Posted On2014-05-14