Incidental Mutation 'R1706:Cav1'
ID190066
Institutional Source Beutler Lab
Gene Symbol Cav1
Ensembl Gene ENSMUSG00000007655
Gene Namecaveolin 1, caveolae protein
Synonymscaveolin-1, Cav-1
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location17306335-17341452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17339182 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 89 (F89L)
Ref Sequence ENSEMBL: ENSMUSP00000111116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007799] [ENSMUST00000115453] [ENSMUST00000115454] [ENSMUST00000115455] [ENSMUST00000115456] [ENSMUST00000123439] [ENSMUST00000177234]
Predicted Effect probably damaging
Transcript: ENSMUST00000007799
AA Change: F89L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007799
Gene: ENSMUSG00000007655
AA Change: F89L

DomainStartEndE-ValueType
Pfam:Caveolin 27 177 4.1e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115453
AA Change: F58L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111113
Gene: ENSMUSG00000007655
AA Change: F58L

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115454
AA Change: F58L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111114
Gene: ENSMUSG00000007655
AA Change: F58L

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115455
AA Change: F78L

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111115
Gene: ENSMUSG00000007655
AA Change: F78L

DomainStartEndE-ValueType
Pfam:Caveolin 16 115 2.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115456
AA Change: F89L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111116
Gene: ENSMUSG00000007655
AA Change: F89L

DomainStartEndE-ValueType
Pfam:Caveolin 42 175 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131334
Predicted Effect probably benign
Transcript: ENSMUST00000177234
Meta Mutation Damage Score 0.6698 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous targeted mutants displayed vascular system dysfunctions and thickening of lung aveloar septa from hyperproliferation and fibrosis, ultimately causing the mice physical limitations. Mice also display increased incidence of calcium calculi, kidney stones, and decreased adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Cav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Cav1 APN 6 17307972 missense possibly damaging 0.93
shortstop UTSW 6 17308035 missense probably damaging 0.99
R0113:Cav1 UTSW 6 17308049 missense possibly damaging 0.60
R0149:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R0361:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R1930:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R1931:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R2166:Cav1 UTSW 6 17339431 missense possibly damaging 0.69
R2655:Cav1 UTSW 6 17339360 missense probably damaging 1.00
R4416:Cav1 UTSW 6 17339249 missense probably benign 0.36
R4460:Cav1 UTSW 6 17306472 missense probably damaging 0.99
R5204:Cav1 UTSW 6 17339255 missense probably damaging 1.00
R5956:Cav1 UTSW 6 17307919 missense probably damaging 1.00
R6467:Cav1 UTSW 6 17308035 missense probably damaging 0.99
R7041:Cav1 UTSW 6 17339144 missense possibly damaging 0.70
R8370:Cav1 UTSW 6 17339294 missense possibly damaging 0.88
R8957:Cav1 UTSW 6 17339236 missense probably benign 0.01
X0026:Cav1 UTSW 6 17339162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTAGTCCTCAGCAGATGACAC -3'
(R):5'- GGAAGCTCTTGATGCACGGTACAAC -3'

Sequencing Primer
(F):5'- ttaaaatacttttctgctccaccc -3'
(R):5'- GTACAACCGCCCAGATGTG -3'
Posted On2014-05-14