Incidental Mutation 'R1706:Lypd3'
ID190071
Institutional Source Beutler Lab
Gene Symbol Lypd3
Ensembl Gene ENSMUSG00000057454
Gene NameLy6/Plaur domain containing 3
Synonyms2310061G07Rik, C4.4A
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24636550-24641118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24640330 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 274 (I274T)
Ref Sequence ENSEMBL: ENSMUSP00000079543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080718]
Predicted Effect probably benign
Transcript: ENSMUST00000080718
AA Change: I274T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079543
Gene: ENSMUSG00000057454
AA Change: I274T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LU 33 128 7.26e-26 SMART
Pfam:UPAR_LY6 142 224 1.3e-16 PFAM
low complexity region 234 255 N/A INTRINSIC
low complexity region 258 278 N/A INTRINSIC
low complexity region 303 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180699
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous null mice show no overt epidermal phenotype and have normal squamous epithelia morphology but are lighter and leaner than controls. Males display delayed wound healing whereas females show reduced food intake and a lower incidence of invasive lesions in a BBN-induced bladder cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Lypd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lypd3 APN 7 24640593 missense probably benign 0.00
IGL01443:Lypd3 APN 7 24636638 missense probably benign 0.03
R0200:Lypd3 UTSW 7 24640231 missense probably damaging 1.00
R0726:Lypd3 UTSW 7 24638544 nonsense probably null
R5714:Lypd3 UTSW 7 24639069 missense possibly damaging 0.86
R5771:Lypd3 UTSW 7 24640362 missense probably benign
R6137:Lypd3 UTSW 7 24640494 missense probably benign 0.00
R6908:Lypd3 UTSW 7 24638433 missense probably damaging 1.00
R6932:Lypd3 UTSW 7 24638433 missense probably damaging 1.00
R6935:Lypd3 UTSW 7 24638433 missense probably damaging 1.00
R7632:Lypd3 UTSW 7 24638440 missense possibly damaging 0.60
R8769:Lypd3 UTSW 7 24638507 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTAACGCCGACCTTCGCAACAAG -3'
(R):5'- ATGAGACATTCACAGCATCGCGCC -3'

Sequencing Primer
(F):5'- GACCTTCGCAACAAGACCTATTTC -3'
(R):5'- AGTGCCAGAGCCTCCTTTAG -3'
Posted On2014-05-14