Incidental Mutation 'R1706:Rccd1'
ID190072
Institutional Source Beutler Lab
Gene Symbol Rccd1
Ensembl Gene ENSMUSG00000038930
Gene NameRCC1 domain containing 1
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1706 (G1)
Quality Score177
Status Validated
Chromosome7
Chromosomal Location80293229-80324454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 80320663 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 69 (G69R)
Ref Sequence ENSEMBL: ENSMUSP00000113273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000047362] [ENSMUST00000047558] [ENSMUST00000107368] [ENSMUST00000121882] [ENSMUST00000123189] [ENSMUST00000154428] [ENSMUST00000163812] [ENSMUST00000173824] [ENSMUST00000174172]
Predicted Effect probably benign
Transcript: ENSMUST00000032748
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047362
AA Change: G69R

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930
AA Change: G69R

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047558
SMART Domains Protein: ENSMUSP00000043379
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.45e-5 PROSPERO
Pfam:MAP65_ASE1 37 602 5.3e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107368
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121882
AA Change: G69R

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113273
Gene: ENSMUSG00000038930
AA Change: G69R

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 7.4e-18 PFAM
Pfam:RCC1_2 216 244 5.5e-10 PFAM
Pfam:RCC1_2 304 332 6.2e-10 PFAM
Pfam:RCC1 319 370 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123109
Predicted Effect probably benign
Transcript: ENSMUST00000123189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148001
Predicted Effect probably benign
Transcript: ENSMUST00000154428
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205863
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Predicted Effect probably benign
Transcript: ENSMUST00000163812
SMART Domains Protein: ENSMUSP00000129675
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.51e-5 PROSPERO
Pfam:MAP65_ASE1 37 605 1.9e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173824
SMART Domains Protein: ENSMUSP00000133910
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
internal_repeat_1 22 36 8.71e-6 PROSPERO
Pfam:MAP65_ASE1 37 565 6e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174172
SMART Domains Protein: ENSMUSP00000133387
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 34 615 2.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174051
SMART Domains Protein: ENSMUSP00000134262
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 244 1.9e-55 PFAM
Meta Mutation Damage Score 0.1112 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Rccd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Rccd1 APN 7 80320218 unclassified probably benign
IGL02024:Rccd1 APN 7 80319007 missense probably benign 0.00
IGL02747:Rccd1 APN 7 80320490 missense probably benign 0.31
IGL02936:Rccd1 APN 7 80317046 missense probably damaging 0.97
K3955:Rccd1 UTSW 7 80320671 missense probably benign 0.04
R0137:Rccd1 UTSW 7 80320578 missense possibly damaging 0.46
R0671:Rccd1 UTSW 7 80320217 unclassified probably benign
R0909:Rccd1 UTSW 7 80319051 splice site probably null
R1588:Rccd1 UTSW 7 80320111 nonsense probably null
R1826:Rccd1 UTSW 7 80320218 unclassified probably benign
R1934:Rccd1 UTSW 7 80320524 missense possibly damaging 0.64
R2983:Rccd1 UTSW 7 80320528 nonsense probably null
R3861:Rccd1 UTSW 7 80320368 missense probably benign 0.00
R7387:Rccd1 UTSW 7 80320602 missense probably benign 0.26
R7967:Rccd1 UTSW 7 80318909 missense possibly damaging 0.86
R8338:Rccd1 UTSW 7 80320870 missense possibly damaging 0.91
X0022:Rccd1 UTSW 7 80320567 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCCAAGAGAGCCTCTCCTTGAGC -3'
(R):5'- AACAGCCACCATTCAGTGTACAGTC -3'

Sequencing Primer
(F):5'- TTCTGGGGTCACATAGGCAC -3'
(R):5'- CATGCCAGTGATGATATTTGCC -3'
Posted On2014-05-14