Incidental Mutation 'R1706:Zfp868'
ID190077
Institutional Source Beutler Lab
Gene Symbol Zfp868
Ensembl Gene ENSMUSG00000060427
Gene Namezinc finger protein 868
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location69610857-69625548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69612409 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 92 (Y92H)
Ref Sequence ENSEMBL: ENSMUSP00000113952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074982] [ENSMUST00000121886]
Predicted Effect probably benign
Transcript: ENSMUST00000074982
AA Change: Y92H

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074510
Gene: ENSMUSG00000060427
AA Change: Y92H

DomainStartEndE-ValueType
KRAB 16 73 1.37e-12 SMART
low complexity region 83 94 N/A INTRINSIC
ZnF_C2H2 155 177 1.06e-4 SMART
ZnF_C2H2 183 205 1.1e-2 SMART
ZnF_C2H2 211 233 7.78e-3 SMART
ZnF_C2H2 239 261 1.36e-2 SMART
ZnF_C2H2 266 288 2.75e-3 SMART
ZnF_C2H2 294 316 4.79e-3 SMART
ZnF_C2H2 322 344 3.89e-3 SMART
ZnF_C2H2 350 372 5.5e-3 SMART
ZnF_C2H2 378 400 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121886
AA Change: Y92H

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113952
Gene: ENSMUSG00000060427
AA Change: Y92H

DomainStartEndE-ValueType
KRAB 16 73 1.37e-12 SMART
low complexity region 83 94 N/A INTRINSIC
ZnF_C2H2 155 177 1.06e-4 SMART
ZnF_C2H2 183 205 1.1e-2 SMART
ZnF_C2H2 211 233 7.78e-3 SMART
ZnF_C2H2 239 261 1.36e-2 SMART
ZnF_C2H2 266 288 2.75e-3 SMART
ZnF_C2H2 294 316 4.79e-3 SMART
ZnF_C2H2 322 344 3.89e-3 SMART
ZnF_C2H2 350 372 5.5e-3 SMART
ZnF_C2H2 378 400 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150118
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Zfp868
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03166:Zfp868 APN 8 69612314 missense probably damaging 0.99
R0546:Zfp868 UTSW 8 69612231 missense probably benign 0.00
R1741:Zfp868 UTSW 8 69611868 missense probably damaging 1.00
R2119:Zfp868 UTSW 8 69611995 nonsense probably null
R2336:Zfp868 UTSW 8 69613907 splice site probably null
R3161:Zfp868 UTSW 8 69612085 missense probably benign 0.01
R5847:Zfp868 UTSW 8 69611652 missense probably damaging 1.00
R6361:Zfp868 UTSW 8 69611913 missense probably damaging 1.00
R6753:Zfp868 UTSW 8 69612096 missense probably benign 0.08
R6855:Zfp868 UTSW 8 69611579 missense probably damaging 1.00
R8310:Zfp868 UTSW 8 69613795 missense probably damaging 1.00
R8420:Zfp868 UTSW 8 69611509 missense probably damaging 1.00
R8458:Zfp868 UTSW 8 69611908 missense possibly damaging 0.57
Z1088:Zfp868 UTSW 8 69611910 frame shift probably null
Z1176:Zfp868 UTSW 8 69612324 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GGTTGGCTTCCTACACACTCTTTGTACT -3'
(R):5'- GCCACCATTGCCTGGCAAGAT -3'

Sequencing Primer
(F):5'- tcctacacactctttgtactcatag -3'
(R):5'- aagaactaacaaaacaaacaagcc -3'
Posted On2014-05-14