Incidental Mutation 'R1706:Luc7l3'
ID190086
Institutional Source Beutler Lab
Gene Symbol Luc7l3
Ensembl Gene ENSMUSG00000020863
Gene NameLUC7-like 3 (S. cerevisiae)
Synonyms3300001P08Rik
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94287890-94321988 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 94297756 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021226] [ENSMUST00000107820] [ENSMUST00000107821] [ENSMUST00000107822] [ENSMUST00000166312]
Predicted Effect probably benign
Transcript: ENSMUST00000021226
SMART Domains Protein: ENSMUSP00000021226
Gene: ENSMUSG00000020863

DomainStartEndE-ValueType
Pfam:LUC7 3 293 2.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107820
SMART Domains Protein: ENSMUSP00000103450
Gene: ENSMUSG00000020863

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107821
SMART Domains Protein: ENSMUSP00000103451
Gene: ENSMUSG00000020863

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107822
Predicted Effect probably benign
Transcript: ENSMUST00000132623
SMART Domains Protein: ENSMUSP00000131166
Gene: ENSMUSG00000020863

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135311
Predicted Effect probably benign
Transcript: ENSMUST00000138369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165620
Predicted Effect probably benign
Transcript: ENSMUST00000166312
SMART Domains Protein: ENSMUSP00000129919
Gene: ENSMUSG00000020863

DomainStartEndE-ValueType
Pfam:LUC7 1 300 7.9e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171033
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal half that contains cysteine/histidine motifs and leucine zipper-like repeats, and the C-terminal half is rich in arginine and glutamate residues (RE domain) and arginine and serine residues (RS domain). This protein localizes with a speckled pattern in the nucleus, and could be involved in the formation of splicesome via the RE and RS domains. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Luc7l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Luc7l3 APN 11 94303942 missense probably benign 0.43
IGL02138:Luc7l3 APN 11 94303966 missense probably benign 0.00
IGL02318:Luc7l3 APN 11 94292993 missense probably benign 0.05
IGL02479:Luc7l3 APN 11 94296909 unclassified probably benign
IGL02563:Luc7l3 APN 11 94300068 splice site probably null
veritas UTSW 11 94292953 missense probably damaging 0.98
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R3803:Luc7l3 UTSW 11 94293166 utr 3 prime probably benign
R4260:Luc7l3 UTSW 11 94296050 unclassified probably benign
R4647:Luc7l3 UTSW 11 94309641 missense probably damaging 1.00
R5153:Luc7l3 UTSW 11 94295980 unclassified probably benign
R5179:Luc7l3 UTSW 11 94300053 missense possibly damaging 0.92
R5591:Luc7l3 UTSW 11 94293234 unclassified probably benign
R6767:Luc7l3 UTSW 11 94292953 missense probably damaging 0.98
R6912:Luc7l3 UTSW 11 94309636 missense probably damaging 0.97
R7168:Luc7l3 UTSW 11 94299984 missense unknown
R7541:Luc7l3 UTSW 11 94295965 missense unknown
Z1177:Luc7l3 UTSW 11 94321775 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAAATTGTCACAGGAATCATCCCTGC -3'
(R):5'- CTCAGGTTGTTCACCAGGAGGTTG -3'

Sequencing Primer
(F):5'- TTACTTTCAGCACTAGAGATCAACC -3'
(R):5'- AGTTGAGCAGCACCTCTG -3'
Posted On2014-05-14