Incidental Mutation 'R1706:Mia2'
ID190088
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 59144766 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 716 (L716*)
Ref Sequence ENSEMBL: ENSMUSP00000151482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069430] [ENSMUST00000170992] [ENSMUST00000175877] [ENSMUST00000175912] [ENSMUST00000176322] [ENSMUST00000176336] [ENSMUST00000176464] [ENSMUST00000176727] [ENSMUST00000176752] [ENSMUST00000176892] [ENSMUST00000177162] [ENSMUST00000177225] [ENSMUST00000177460] [ENSMUST00000219140] [ENSMUST00000177370]
Predicted Effect probably null
Transcript: ENSMUST00000069430
AA Change: L113*
SMART Domains Protein: ENSMUSP00000070572
Gene: ENSMUSG00000021000
AA Change: L113*

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 124 253 9e-6 SMART
SCOP:d1fxkc_ 314 437 3e-16 SMART
low complexity region 480 493 N/A INTRINSIC
low complexity region 533 556 N/A INTRINSIC
low complexity region 682 700 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 722 742 N/A INTRINSIC
low complexity region 751 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170992
SMART Domains Protein: ENSMUSP00000126538
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 102 231 2e-6 SMART
SCOP:d1fxkc_ 292 415 2e-17 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 685 695 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175803
Predicted Effect probably benign
Transcript: ENSMUST00000175877
SMART Domains Protein: ENSMUSP00000135440
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d1fxkc_ 74 203 1e-5 SMART
SCOP:d1fxkc_ 264 387 6e-16 SMART
low complexity region 430 443 N/A INTRINSIC
low complexity region 589 607 N/A INTRINSIC
low complexity region 614 624 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
low complexity region 658 682 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175912
AA Change: L113*
SMART Domains Protein: ENSMUSP00000135251
Gene: ENSMUSG00000021000
AA Change: L113*

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 115 244 8e-6 SMART
SCOP:d1fxkc_ 305 428 2e-16 SMART
low complexity region 471 484 N/A INTRINSIC
low complexity region 524 547 N/A INTRINSIC
low complexity region 673 691 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
low complexity region 713 733 N/A INTRINSIC
low complexity region 742 766 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176322
AA Change: L124*
SMART Domains Protein: ENSMUSP00000135100
Gene: ENSMUSG00000021000
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 135 264 4e-6 SMART
SCOP:d1fxkc_ 325 448 9e-17 SMART
low complexity region 491 504 N/A INTRINSIC
low complexity region 544 567 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 718 728 N/A INTRINSIC
low complexity region 733 753 N/A INTRINSIC
low complexity region 762 786 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176336
AA Change: L89*
SMART Domains Protein: ENSMUSP00000134872
Gene: ENSMUSG00000021000
AA Change: L89*

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
coiled coil region 55 235 N/A INTRINSIC
SCOP:d1fxkc_ 281 404 6e-8 SMART
low complexity region 447 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176464
AA Change: L124*
SMART Domains Protein: ENSMUSP00000135390
Gene: ENSMUSG00000021000
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 4e-6 SMART
SCOP:d1fxkc_ 316 439 8e-17 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 535 558 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
low complexity region 709 719 N/A INTRINSIC
low complexity region 724 744 N/A INTRINSIC
low complexity region 753 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176617
Predicted Effect probably benign
Transcript: ENSMUST00000176727
SMART Domains Protein: ENSMUSP00000135694
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176752
SMART Domains Protein: ENSMUSP00000134972
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176892
SMART Domains Protein: ENSMUSP00000135245
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
SCOP:d1fxkc_ 91 220 4e-6 SMART
SCOP:d1fxkc_ 281 404 8e-17 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
low complexity region 649 667 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 718 742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177162
AA Change: L124*
SMART Domains Protein: ENSMUSP00000135001
Gene: ENSMUSG00000021000
AA Change: L124*

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
SCOP:d1fxkc_ 126 255 2e-5 SMART
SCOP:d1fxkc_ 316 439 8e-16 SMART
low complexity region 482 495 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
low complexity region 666 676 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
low complexity region 710 734 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177225
AA Change: L96*
SMART Domains Protein: ENSMUSP00000135618
Gene: ENSMUSG00000021000
AA Change: L96*

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
SCOP:d1fxkc_ 98 227 3e-5 SMART
SCOP:d1fxkc_ 288 411 2e-15 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 613 631 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
low complexity region 653 673 N/A INTRINSIC
low complexity region 682 706 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177460
AA Change: L118*
SMART Domains Protein: ENSMUSP00000134887
Gene: ENSMUSG00000021000
AA Change: L118*

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
coiled coil region 84 116 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219140
AA Change: L716*
Predicted Effect probably benign
Transcript: ENSMUST00000177370
SMART Domains Protein: ENSMUSP00000135179
Gene: ENSMUSG00000021000

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
coiled coil region 95 167 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6676:Mia2 UTSW 12 59108370 missense probably damaging 0.97
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
R7874:Mia2 UTSW 12 59108588 missense probably damaging 0.99
R7894:Mia2 UTSW 12 59189647 missense probably damaging 1.00
R7961:Mia2 UTSW 12 59159639 critical splice donor site probably null
R7980:Mia2 UTSW 12 59108865 missense probably damaging 0.98
R8110:Mia2 UTSW 12 59109087 splice site probably null
R8557:Mia2 UTSW 12 59101488 missense probably damaging 0.97
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Z1176:Mia2 UTSW 12 59108124 missense probably benign 0.27
Z1176:Mia2 UTSW 12 59108801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACAGTGGTTAGATGGCAGAAC -3'
(R):5'- CGTCTCCTTCCTGAAGCAAGCAATG -3'

Sequencing Primer
(F):5'- CTAAGCTCAGAGTTTGCTTCACAG -3'
(R):5'- AGGAGCCATCTCTTCAATGC -3'
Posted On2014-05-14