Incidental Mutation 'R1706:Ttc8'
ID190089
Institutional Source Beutler Lab
Gene Symbol Ttc8
Ensembl Gene ENSMUSG00000021013
Gene Nametetratricopeptide repeat domain 8
SynonymsBBS8, 0610012F22Rik
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98920574-98983238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98943883 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 123 (T123K)
Ref Sequence ENSEMBL: ENSMUSP00000115828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079146] [ENSMUST00000085109] [ENSMUST00000132878]
Predicted Effect probably benign
Transcript: ENSMUST00000079146
AA Change: T183K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078148
Gene: ENSMUSG00000021013
AA Change: T183K

DomainStartEndE-ValueType
Blast:TPR 4 37 5e-12 BLAST
TPR 225 258 2.35e-1 SMART
TPR 292 325 9.68e-3 SMART
Blast:TPR 326 359 3e-14 BLAST
TPR 360 393 2.26e-3 SMART
TPR 397 430 1.91e-1 SMART
TPR 431 464 1.81e-2 SMART
Blast:TPR 465 498 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000085109
AA Change: T173K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082190
Gene: ENSMUSG00000021013
AA Change: T173K

DomainStartEndE-ValueType
Blast:TPR 4 37 4e-12 BLAST
TPR 215 248 2.35e-1 SMART
TPR 282 315 9.68e-3 SMART
Blast:TPR 316 349 3e-14 BLAST
TPR 350 383 2.26e-3 SMART
TPR 387 420 1.91e-1 SMART
TPR 421 454 1.81e-2 SMART
Blast:TPR 455 488 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124514
Predicted Effect probably benign
Transcript: ENSMUST00000132878
AA Change: T123K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115828
Gene: ENSMUSG00000021013
AA Change: T123K

DomainStartEndE-ValueType
SCOP:d1a17__ 128 206 2e-5 SMART
Blast:TPR 165 198 8e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223356
Meta Mutation Damage Score 0.0982 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is involved in the formation of cilia. A mutation in this gene has also been implicated in nonsyndromic retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality with slow postnatal weight gain, age related obesity, impaired olfation, loss of cilia from the olfactory epithelium, impaired targeting of olfactory sensory neuron axons, retinal degeneration, and mild renal tubule dilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Ttc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Ttc8 APN 12 98976018 missense probably damaging 0.96
IGL01139:Ttc8 APN 12 98964545 nonsense probably null
IGL02179:Ttc8 APN 12 98964537 missense possibly damaging 0.87
IGL02715:Ttc8 APN 12 98943920 splice site probably benign
IGL02958:Ttc8 APN 12 98964544 missense probably benign 0.03
IGL03249:Ttc8 APN 12 98943821 splice site probably benign
P0035:Ttc8 UTSW 12 98976416 splice site probably benign
R0606:Ttc8 UTSW 12 98943459 splice site probably benign
R1005:Ttc8 UTSW 12 98937144 missense probably benign 0.11
R1584:Ttc8 UTSW 12 98920764 missense probably benign 0.01
R1628:Ttc8 UTSW 12 98982521 missense probably benign 0.07
R4585:Ttc8 UTSW 12 98982530 missense probably benign
R4720:Ttc8 UTSW 12 98979809 missense possibly damaging 0.94
R4879:Ttc8 UTSW 12 98942303 missense possibly damaging 0.55
R5110:Ttc8 UTSW 12 98942303 missense probably benign 0.25
R6272:Ttc8 UTSW 12 98982494 missense possibly damaging 0.63
R6465:Ttc8 UTSW 12 98964570 missense probably damaging 1.00
R6620:Ttc8 UTSW 12 98957320 missense possibly damaging 0.95
R6708:Ttc8 UTSW 12 98943532 missense probably damaging 0.99
R6772:Ttc8 UTSW 12 98943589 missense probably damaging 1.00
R6901:Ttc8 UTSW 12 98961476 missense probably damaging 1.00
R7060:Ttc8 UTSW 12 98943467 missense probably benign
R7117:Ttc8 UTSW 12 98976502 missense possibly damaging 0.63
R7174:Ttc8 UTSW 12 98974701 missense possibly damaging 0.79
R7385:Ttc8 UTSW 12 98942288 missense possibly damaging 0.78
R7447:Ttc8 UTSW 12 98943872 missense probably damaging 0.97
R7589:Ttc8 UTSW 12 98976437 missense probably damaging 1.00
R8517:Ttc8 UTSW 12 98943335 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGTACAATGGAACAGGCCATCAG -3'
(R):5'- CAGACAGTGTCAAGCTTCGTCCTAC -3'

Sequencing Primer
(F):5'- CACTAGCTCATCTGGAAGATTCG -3'
(R):5'- AAAGATGATACTGCCTCTCTGCG -3'
Posted On2014-05-14