Incidental Mutation 'R1706:Adcy2'
ID190092
Institutional Source Beutler Lab
Gene Symbol Adcy2
Ensembl Gene ENSMUSG00000021536
Gene Nameadenylate cyclase 2
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location68620043-68999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68720746 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 558 (N558I)
Ref Sequence ENSEMBL: ENSMUSP00000022013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022013]
Predicted Effect probably damaging
Transcript: ENSMUST00000022013
AA Change: N558I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: N558I

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
CYCc 239 447 6.62e-66 SMART
Pfam:DUF1053 499 604 2.6e-41 PFAM
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
transmembrane domain 684 706 N/A INTRINSIC
transmembrane domain 738 760 N/A INTRINSIC
transmembrane domain 767 789 N/A INTRINSIC
transmembrane domain 809 826 N/A INTRINSIC
CYCc 851 1065 5.49e-40 SMART
Meta Mutation Damage Score 0.1536 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Adcy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Adcy2 APN 13 68620796 missense probably damaging 1.00
IGL01074:Adcy2 APN 13 68796654 missense possibly damaging 0.93
IGL01394:Adcy2 APN 13 68982402 missense probably damaging 1.00
IGL01820:Adcy2 APN 13 68738545 splice site probably null
IGL02048:Adcy2 APN 13 68888067 missense possibly damaging 0.46
IGL02378:Adcy2 APN 13 68730292 missense probably damaging 1.00
IGL02419:Adcy2 APN 13 68982363 missense probably benign 0.40
IGL02896:Adcy2 APN 13 68727872 missense probably damaging 1.00
IGL02953:Adcy2 APN 13 68729328 missense probably damaging 1.00
IGL03358:Adcy2 APN 13 68729277 missense probably damaging 1.00
IGL03387:Adcy2 APN 13 68730367 missense probably damaging 1.00
PIT4305001:Adcy2 UTSW 13 68678602 missense probably benign 0.00
PIT4366001:Adcy2 UTSW 13 68709990 critical splice donor site probably benign
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0083:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0108:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0269:Adcy2 UTSW 13 68678606 nonsense probably null
R0369:Adcy2 UTSW 13 68671900 missense probably benign 0.00
R0480:Adcy2 UTSW 13 68732112 missense probably damaging 1.00
R0550:Adcy2 UTSW 13 68982361 missense probably benign 0.23
R0551:Adcy2 UTSW 13 68796539 missense probably damaging 1.00
R0617:Adcy2 UTSW 13 68678606 nonsense probably null
R0634:Adcy2 UTSW 13 68727945 missense possibly damaging 0.48
R0715:Adcy2 UTSW 13 68888042 missense probably benign 0.08
R0723:Adcy2 UTSW 13 68999129 missense probably damaging 1.00
R1136:Adcy2 UTSW 13 68730317 missense probably damaging 1.00
R1271:Adcy2 UTSW 13 68642498 missense probably damaging 1.00
R1349:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1372:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1390:Adcy2 UTSW 13 68657393 missense possibly damaging 0.94
R1495:Adcy2 UTSW 13 68796535 missense probably benign 0.30
R1839:Adcy2 UTSW 13 68689261 splice site probably null
R2004:Adcy2 UTSW 13 68796603 missense probably damaging 1.00
R2235:Adcy2 UTSW 13 68668492 missense probably damaging 0.98
R2242:Adcy2 UTSW 13 68689341 missense probably benign 0.00
R2940:Adcy2 UTSW 13 68730305 missense probably damaging 1.00
R3624:Adcy2 UTSW 13 68642531 missense probably damaging 0.99
R3689:Adcy2 UTSW 13 68630969 missense probably damaging 1.00
R4685:Adcy2 UTSW 13 68727905 missense probably benign 0.32
R4695:Adcy2 UTSW 13 68727843 missense possibly damaging 0.67
R5213:Adcy2 UTSW 13 68620823 missense possibly damaging 0.61
R5645:Adcy2 UTSW 13 68729202 splice site probably null
R5687:Adcy2 UTSW 13 68620819 nonsense probably null
R5687:Adcy2 UTSW 13 68642569 missense probably damaging 1.00
R5833:Adcy2 UTSW 13 68738603 missense probably benign
R5846:Adcy2 UTSW 13 68738588 missense probably damaging 0.99
R5894:Adcy2 UTSW 13 68625852 missense probably damaging 1.00
R6111:Adcy2 UTSW 13 68729241 missense probably damaging 0.99
R6311:Adcy2 UTSW 13 68625792 missense probably damaging 1.00
R6642:Adcy2 UTSW 13 68620826 missense probably damaging 1.00
R6644:Adcy2 UTSW 13 68668552 missense possibly damaging 0.88
R6899:Adcy2 UTSW 13 68982381 missense probably damaging 0.99
R6917:Adcy2 UTSW 13 68620757 missense possibly damaging 0.68
R6950:Adcy2 UTSW 13 68888065 missense possibly damaging 0.93
R7006:Adcy2 UTSW 13 68888020 missense probably damaging 1.00
R7186:Adcy2 UTSW 13 68668639 missense probably damaging 1.00
R7311:Adcy2 UTSW 13 68630954 missense probably damaging 1.00
R7348:Adcy2 UTSW 13 68734675 missense possibly damaging 0.79
R7440:Adcy2 UTSW 13 68796667 missense probably damaging 0.97
R7463:Adcy2 UTSW 13 68730280 missense probably damaging 1.00
R7827:Adcy2 UTSW 13 68689281 missense probably damaging 1.00
R7919:Adcy2 UTSW 13 68887972 missense probably benign 0.08
R8144:Adcy2 UTSW 13 68734635 nonsense probably null
R8256:Adcy2 UTSW 13 68620761 missense probably damaging 1.00
R8556:Adcy2 UTSW 13 68630975 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTCATGGAAGCATTGGCTAGGAGAC -3'
(R):5'- AGCTTTGAGATGCCCAAACAGAGAC -3'

Sequencing Primer
(F):5'- GCATTGGCTAGGAGACACTTG -3'
(R):5'- CCAGTGGTGATTTGAAATCCCAG -3'
Posted On2014-05-14