Incidental Mutation 'R1706:4921524L21Rik'
ID190103
Institutional Source Beutler Lab
Gene Symbol 4921524L21Rik
Ensembl Gene ENSMUSG00000039540
Gene NameRIKEN cDNA 4921524L21 gene
Synonyms
MMRRC Submission 039739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1706 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6603633-6638966 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 6624059 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044829]
Predicted Effect probably benign
Transcript: ENSMUST00000044829
SMART Domains Protein: ENSMUSP00000035514
Gene: ENSMUSG00000039540

DomainStartEndE-ValueType
Pfam:DUF3496 131 235 6.9e-12 PFAM
coiled coil region 269 292 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Neu3 A G 7: 99,823,356 L58P probably damaging Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in 4921524L21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:4921524L21Rik APN 18 6629578 missense possibly damaging 0.93
IGL01402:4921524L21Rik APN 18 6638653 missense possibly damaging 0.65
IGL01404:4921524L21Rik APN 18 6638653 missense possibly damaging 0.65
IGL02680:4921524L21Rik APN 18 6635949 splice site probably benign
PIT4812001:4921524L21Rik UTSW 18 6630053 missense possibly damaging 0.93
R0532:4921524L21Rik UTSW 18 6638618 missense possibly damaging 0.83
R1069:4921524L21Rik UTSW 18 6624037 missense probably benign 0.01
R1768:4921524L21Rik UTSW 18 6623470 missense possibly damaging 0.72
R1912:4921524L21Rik UTSW 18 6620205 missense possibly damaging 0.72
R3820:4921524L21Rik UTSW 18 6630166 critical splice donor site probably null
R3840:4921524L21Rik UTSW 18 6620104 missense probably benign 0.44
R3841:4921524L21Rik UTSW 18 6620104 missense probably benign 0.44
R4201:4921524L21Rik UTSW 18 6623952 critical splice acceptor site probably null
R4852:4921524L21Rik UTSW 18 6623487 missense possibly damaging 0.91
R4852:4921524L21Rik UTSW 18 6623488 missense probably damaging 0.99
R5218:4921524L21Rik UTSW 18 6629628 missense possibly damaging 0.63
R5389:4921524L21Rik UTSW 18 6638795 missense probably benign 0.14
R5428:4921524L21Rik UTSW 18 6635918 missense probably benign 0.04
R5873:4921524L21Rik UTSW 18 6630167 critical splice donor site probably null
R6120:4921524L21Rik UTSW 18 6638795 missense possibly damaging 0.85
R6345:4921524L21Rik UTSW 18 6626399 missense possibly damaging 0.71
R7246:4921524L21Rik UTSW 18 6635902 missense probably damaging 0.98
R7296:4921524L21Rik UTSW 18 6626385 missense probably damaging 0.99
R8796:4921524L21Rik UTSW 18 6629482 missense possibly damaging 0.95
Z1177:4921524L21Rik UTSW 18 6635865 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGAGCACTACACCTATGTGAGC -3'
(R):5'- TCAGTCAATTTCTGTAAAGCCAGAGGAC -3'

Sequencing Primer
(F):5'- ggggcagggaataagtcag -3'
(R):5'- CTGTAAAGCCAGAGGACTTTCATC -3'
Posted On2014-05-14