Incidental Mutation 'R1707:Intu'
ID 190119
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik
MMRRC Submission 039740-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1707 (G1)
Quality Score 88
Status Validated
Chromosome 3
Chromosomal Location 40531286-40704774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40540924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 21 (S21T)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably benign
Transcript: ENSMUST00000061590
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: S21T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: S21T

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Meta Mutation Damage Score 0.0793 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 160,070,802 probably benign Het
4931429P17Rik A G 13: 47,961,005 noncoding transcript Het
Acox3 T A 5: 35,601,564 I373N possibly damaging Het
Adgrb1 G T 15: 74,529,343 A63S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplp2 A T 9: 31,150,919 H692Q probably damaging Het
Arhgap24 T C 5: 102,892,087 S297P probably benign Het
Arhgap9 C T 10: 127,328,889 P561S probably benign Het
Arhgef10l T G 4: 140,564,289 D62A probably damaging Het
Asb14 T G 14: 26,901,122 F150L probably benign Het
Atp8b3 A T 10: 80,521,801 probably null Het
Atrnl1 A G 19: 57,686,737 D686G probably benign Het
Bmpr1a A T 14: 34,425,141 probably benign Het
C330027C09Rik A C 16: 49,018,404 Q861H probably damaging Het
Cc2d2a T A 5: 43,723,688 probably null Het
Ccin T A 4: 43,983,947 I118N probably benign Het
Cd8b1 G A 6: 71,326,184 G81D probably damaging Het
Cep126 G A 9: 8,100,382 S717L probably benign Het
Colgalt2 C T 1: 152,400,363 R76W probably damaging Het
Copg1 A T 6: 87,905,210 T596S probably benign Het
Cpb1 G A 3: 20,275,491 R24W probably damaging Het
Csad T A 15: 102,179,972 D134V probably damaging Het
Dchs2 A G 3: 83,127,605 probably benign Het
Ddb2 A G 2: 91,234,209 W119R probably damaging Het
Dhx57 A T 17: 80,275,226 S317T probably damaging Het
Dlc1 A G 8: 36,937,609 V342A probably benign Het
Dpp4 G A 2: 62,359,335 probably benign Het
Dst G T 1: 34,167,646 W1005L probably damaging Het
Ehmt1 T C 2: 24,805,138 M989V probably benign Het
Gm17660 T A 5: 104,074,233 probably benign Het
Gm5422 G A 10: 31,248,462 noncoding transcript Het
Gm9944 A G 4: 144,453,263 probably benign Het
Gtf2ird2 T C 5: 134,216,987 Y696H probably damaging Het
H2-M11 T G 17: 36,548,766 V217G probably damaging Het
Hrasls A G 16: 29,228,226 K166E probably damaging Het
Hunk C T 16: 90,386,407 probably benign Het
Impg1 T C 9: 80,378,517 probably null Het
Ints11 T G 4: 155,875,198 D87E probably benign Het
Kbtbd3 T A 9: 4,316,985 N45K probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klrg2 C G 6: 38,636,794 E91D possibly damaging Het
Lamc3 T C 2: 31,912,129 probably null Het
Magi2 T G 5: 20,215,493 M309R probably damaging Het
Magohb G A 6: 131,284,637 P147S probably damaging Het
Mdn1 A G 4: 32,693,504 D1043G probably damaging Het
Mtmr3 T C 11: 4,504,095 D203G probably damaging Het
Mvp C T 7: 127,001,572 V86I probably benign Het
Naip5 A T 13: 100,242,855 F226I probably damaging Het
Nasp T A 4: 116,618,936 Q51L probably damaging Het
Nf1 T A 11: 79,535,604 F1594I probably damaging Het
Nod2 A C 8: 88,670,476 E816A possibly damaging Het
Nom1 G A 5: 29,435,318 S214N probably damaging Het
Olfr168 T C 16: 19,530,177 T248A probably benign Het
Olfr25 T A 9: 38,329,901 F105I probably damaging Het
Parp14 A C 16: 35,857,849 L583R probably damaging Het
Pclo T C 5: 14,713,224 S3904P unknown Het
Pkhd1 T A 1: 20,550,840 probably benign Het
Polr1e A C 4: 45,027,469 D233A probably damaging Het
Prr29 T C 11: 106,376,683 V124A probably damaging Het
Rasgrp1 A T 2: 117,298,547 V197E probably damaging Het
Rgma A T 7: 73,417,959 T415S unknown Het
Sacs G T 14: 61,209,762 V3086L probably benign Het
Sash1 A G 10: 8,730,377 S750P probably benign Het
Sdccag3 T A 2: 26,387,606 N69Y probably damaging Het
Sema6a A T 18: 47,283,445 S372T probably benign Het
Sis A G 3: 72,909,087 probably benign Het
Skint8 T A 4: 111,939,572 V291D probably damaging Het
Slc12a8 A G 16: 33,551,007 N171S probably damaging Het
Slc25a40 G A 5: 8,440,793 probably null Het
Spag6l A T 16: 16,780,628 I333N probably benign Het
Sspo T A 6: 48,477,877 F2999L probably damaging Het
Stambpl1 A C 19: 34,238,821 T363P probably damaging Het
Tenm4 A T 7: 96,888,685 N1785Y probably damaging Het
Tln2 C T 9: 67,375,807 S293N probably benign Het
Tmed3 G A 9: 89,702,780 L141F probably damaging Het
Tmem30c G T 16: 57,266,480 T320K possibly damaging Het
Tnn T C 1: 160,145,144 Y296C probably damaging Het
Ttn C T 2: 76,790,086 A15802T probably damaging Het
Usp53 T C 3: 122,947,400 M734V probably benign Het
Vmn1r24 A G 6: 57,956,512 I7T probably benign Het
Vmn1r74 T A 7: 11,847,577 V268E probably damaging Het
Xirp1 A T 9: 120,018,775 H347Q possibly damaging Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40664266 missense probably benign 0.12
IGL01386:Intu APN 3 40692587 missense probably damaging 1.00
IGL02645:Intu APN 3 40701272 missense probably benign 0.01
IGL02869:Intu APN 3 40687786 missense probably damaging 1.00
IGL03263:Intu APN 3 40672597 nonsense probably null
H8562:Intu UTSW 3 40692673 missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40697603 missense probably benign 0.07
R0010:Intu UTSW 3 40654272 intron probably benign
R0173:Intu UTSW 3 40675346 critical splice donor site probably null
R0426:Intu UTSW 3 40675305 missense probably damaging 0.97
R1566:Intu UTSW 3 40692578 missense probably damaging 0.99
R1619:Intu UTSW 3 40697631 nonsense probably null
R1658:Intu UTSW 3 40692781 missense probably benign 0.20
R1701:Intu UTSW 3 40664264 missense probably damaging 1.00
R1707:Intu UTSW 3 40683501 missense possibly damaging 0.69
R1867:Intu UTSW 3 40664335 missense probably damaging 1.00
R1868:Intu UTSW 3 40664335 missense probably damaging 1.00
R2090:Intu UTSW 3 40683536 missense probably benign 0.00
R2310:Intu UTSW 3 40653813 missense probably benign
R2989:Intu UTSW 3 40692710 missense probably benign 0.11
R4168:Intu UTSW 3 40672623 missense probably benign 0.00
R4530:Intu UTSW 3 40683364 missense possibly damaging 0.95
R5093:Intu UTSW 3 40692917 missense probably benign 0.00
R5541:Intu UTSW 3 40692587 splice site probably null
R5587:Intu UTSW 3 40675308 missense probably damaging 0.99
R5745:Intu UTSW 3 40692972 splice site probably null
R5809:Intu UTSW 3 40679590 missense probably damaging 0.99
R5939:Intu UTSW 3 40692584 missense probably damaging 1.00
R5953:Intu UTSW 3 40679550 missense probably damaging 1.00
R6000:Intu UTSW 3 40654148 nonsense probably null
R6063:Intu UTSW 3 40654094 missense probably damaging 0.97
R6245:Intu UTSW 3 40675326 missense probably damaging 0.98
R6310:Intu UTSW 3 40701291 nonsense probably null
R6353:Intu UTSW 3 40653708 missense probably damaging 1.00
R6451:Intu UTSW 3 40701293 missense possibly damaging 0.94
R6660:Intu UTSW 3 40531951 missense probably benign 0.00
R6848:Intu UTSW 3 40694255 missense probably benign 0.00
R7440:Intu UTSW 3 40697551 missense probably benign 0.04
R7625:Intu UTSW 3 40697599 missense probably benign
R7633:Intu UTSW 3 40654253 missense probably damaging 1.00
R7798:Intu UTSW 3 40691929 missense probably damaging 1.00
R7877:Intu UTSW 3 40699792 missense probably benign 0.07
R7978:Intu UTSW 3 40697639 missense probably damaging 1.00
R8319:Intu UTSW 3 40653772 missense probably damaging 1.00
R8332:Intu UTSW 3 40675289 missense probably benign 0.35
R8860:Intu UTSW 3 40672732 missense probably benign 0.07
R8926:Intu UTSW 3 40653709 missense possibly damaging 0.69
R8946:Intu UTSW 3 40683359 missense possibly damaging 0.93
R9164:Intu UTSW 3 40690703 missense probably damaging 1.00
R9191:Intu UTSW 3 40692511 missense probably damaging 0.99
R9547:Intu UTSW 3 40654106 missense probably benign
Z1177:Intu UTSW 3 40697516 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGCCAATCGCAACTGAGTATCGGG -3'
(R):5'- GGCAGTGCTACAGAGCACAACAATG -3'

Sequencing Primer
(F):5'- CAACTGAGTATCGGGGTCAC -3'
(R):5'- ccacccccaccccTTATC -3'
Posted On 2014-05-14