Incidental Mutation 'R1707:Nasp'
ID190130
Institutional Source Beutler Lab
Gene Symbol Nasp
Ensembl Gene ENSMUSG00000028693
Gene Namenuclear autoantigenic sperm protein (histone-binding)
SynonymsD4Ertd767e, 5033430J04Rik, Epcs32, Nasp-T
MMRRC Submission 039740-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1707 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116601052-116627941 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116618936 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 51 (Q51L)
Ref Sequence ENSEMBL: ENSMUSP00000079946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030456] [ENSMUST00000030457] [ENSMUST00000081182]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030456
AA Change: Q51L

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030456
Gene: ENSMUSG00000028693
AA Change: Q51L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
TPR 528 561 3.05e0 SMART
TPR 570 603 2.38e-2 SMART
low complexity region 620 640 N/A INTRINSIC
low complexity region 703 715 N/A INTRINSIC
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000030457
AA Change: Q51L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030457
Gene: ENSMUSG00000028693
AA Change: Q51L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 8.51e0 SMART
low complexity region 111 126 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
TPR 203 236 3.05e0 SMART
TPR 245 278 2.38e-2 SMART
low complexity region 295 315 N/A INTRINSIC
low complexity region 378 390 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081182
AA Change: Q51L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079946
Gene: ENSMUSG00000028693
AA Change: Q51L

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
TPR 43 76 6.2e-2 SMART
low complexity region 84 99 N/A INTRINSIC
low complexity region 106 126 N/A INTRINSIC
low complexity region 140 151 N/A INTRINSIC
TPR 176 209 1.4e-2 SMART
TPR 218 251 1.1e-4 SMART
low complexity region 268 288 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 390 407 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154811
Meta Mutation Damage Score 0.1637 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 160,070,802 probably benign Het
4931429P17Rik A G 13: 47,961,005 noncoding transcript Het
Acox3 T A 5: 35,601,564 I373N possibly damaging Het
Adgrb1 G T 15: 74,529,343 A63S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplp2 A T 9: 31,150,919 H692Q probably damaging Het
Arhgap24 T C 5: 102,892,087 S297P probably benign Het
Arhgap9 C T 10: 127,328,889 P561S probably benign Het
Arhgef10l T G 4: 140,564,289 D62A probably damaging Het
Asb14 T G 14: 26,901,122 F150L probably benign Het
Atp8b3 A T 10: 80,521,801 probably null Het
Atrnl1 A G 19: 57,686,737 D686G probably benign Het
Bmpr1a A T 14: 34,425,141 probably benign Het
C330027C09Rik A C 16: 49,018,404 Q861H probably damaging Het
Cc2d2a T A 5: 43,723,688 probably null Het
Ccin T A 4: 43,983,947 I118N probably benign Het
Cd8b1 G A 6: 71,326,184 G81D probably damaging Het
Cep126 G A 9: 8,100,382 S717L probably benign Het
Colgalt2 C T 1: 152,400,363 R76W probably damaging Het
Copg1 A T 6: 87,905,210 T596S probably benign Het
Cpb1 G A 3: 20,275,491 R24W probably damaging Het
Csad T A 15: 102,179,972 D134V probably damaging Het
Dchs2 A G 3: 83,127,605 probably benign Het
Ddb2 A G 2: 91,234,209 W119R probably damaging Het
Dhx57 A T 17: 80,275,226 S317T probably damaging Het
Dlc1 A G 8: 36,937,609 V342A probably benign Het
Dpp4 G A 2: 62,359,335 probably benign Het
Dst G T 1: 34,167,646 W1005L probably damaging Het
Ehmt1 T C 2: 24,805,138 M989V probably benign Het
Gm17660 T A 5: 104,074,233 probably benign Het
Gm5422 G A 10: 31,248,462 noncoding transcript Het
Gm9944 A G 4: 144,453,263 probably benign Het
Gtf2ird2 T C 5: 134,216,987 Y696H probably damaging Het
H2-M11 T G 17: 36,548,766 V217G probably damaging Het
Hrasls A G 16: 29,228,226 K166E probably damaging Het
Hunk C T 16: 90,386,407 probably benign Het
Impg1 T C 9: 80,378,517 probably null Het
Ints11 T G 4: 155,875,198 D87E probably benign Het
Intu T A 3: 40,540,924 S21T probably benign Het
Intu C A 3: 40,683,501 D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 N45K probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klrg2 C G 6: 38,636,794 E91D possibly damaging Het
Lamc3 T C 2: 31,912,129 probably null Het
Magi2 T G 5: 20,215,493 M309R probably damaging Het
Magohb G A 6: 131,284,637 P147S probably damaging Het
Mdn1 A G 4: 32,693,504 D1043G probably damaging Het
Mtmr3 T C 11: 4,504,095 D203G probably damaging Het
Mvp C T 7: 127,001,572 V86I probably benign Het
Naip5 A T 13: 100,242,855 F226I probably damaging Het
Nf1 T A 11: 79,535,604 F1594I probably damaging Het
Nod2 A C 8: 88,670,476 E816A possibly damaging Het
Nom1 G A 5: 29,435,318 S214N probably damaging Het
Olfr168 T C 16: 19,530,177 T248A probably benign Het
Olfr25 T A 9: 38,329,901 F105I probably damaging Het
Parp14 A C 16: 35,857,849 L583R probably damaging Het
Pclo T C 5: 14,713,224 S3904P unknown Het
Pkhd1 T A 1: 20,550,840 probably benign Het
Polr1e A C 4: 45,027,469 D233A probably damaging Het
Prr29 T C 11: 106,376,683 V124A probably damaging Het
Rasgrp1 A T 2: 117,298,547 V197E probably damaging Het
Rgma A T 7: 73,417,959 T415S unknown Het
Sacs G T 14: 61,209,762 V3086L probably benign Het
Sash1 A G 10: 8,730,377 S750P probably benign Het
Sdccag3 T A 2: 26,387,606 N69Y probably damaging Het
Sema6a A T 18: 47,283,445 S372T probably benign Het
Sis A G 3: 72,909,087 probably benign Het
Skint8 T A 4: 111,939,572 V291D probably damaging Het
Slc12a8 A G 16: 33,551,007 N171S probably damaging Het
Slc25a40 G A 5: 8,440,793 probably null Het
Spag6l A T 16: 16,780,628 I333N probably benign Het
Sspo T A 6: 48,477,877 F2999L probably damaging Het
Stambpl1 A C 19: 34,238,821 T363P probably damaging Het
Tenm4 A T 7: 96,888,685 N1785Y probably damaging Het
Tln2 C T 9: 67,375,807 S293N probably benign Het
Tmed3 G A 9: 89,702,780 L141F probably damaging Het
Tmem30c G T 16: 57,266,480 T320K possibly damaging Het
Tnn T C 1: 160,145,144 Y296C probably damaging Het
Ttn C T 2: 76,790,086 A15802T probably damaging Het
Usp53 T C 3: 122,947,400 M734V probably benign Het
Vmn1r24 A G 6: 57,956,512 I7T probably benign Het
Vmn1r74 T A 7: 11,847,577 V268E probably damaging Het
Xirp1 A T 9: 120,018,775 H347Q possibly damaging Het
Other mutations in Nasp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nasp APN 4 116604219 missense probably damaging 1.00
IGL00780:Nasp APN 4 116603999 nonsense probably null
IGL00833:Nasp APN 4 116602736 missense probably damaging 1.00
IGL02232:Nasp APN 4 116604800 missense probably damaging 0.99
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0023:Nasp UTSW 4 116605771 splice site probably benign
R0179:Nasp UTSW 4 116602157 missense probably damaging 1.00
R0385:Nasp UTSW 4 116610695 missense probably benign 0.02
R1945:Nasp UTSW 4 116622768 missense possibly damaging 0.62
R2061:Nasp UTSW 4 116611126 missense probably benign 0.12
R4983:Nasp UTSW 4 116602185 missense probably damaging 0.99
R5064:Nasp UTSW 4 116611970 critical splice donor site probably null
R5687:Nasp UTSW 4 116605805 intron probably benign
R5713:Nasp UTSW 4 116614361 missense probably benign 0.34
R5839:Nasp UTSW 4 116602091 critical splice donor site probably null
R6145:Nasp UTSW 4 116611077 missense probably benign 0.19
R6159:Nasp UTSW 4 116603889 splice site probably null
R6234:Nasp UTSW 4 116622782 missense possibly damaging 0.51
R6286:Nasp UTSW 4 116604788 missense probably damaging 1.00
R6483:Nasp UTSW 4 116618948 missense probably damaging 1.00
R6899:Nasp UTSW 4 116604333 missense probably damaging 1.00
R7276:Nasp UTSW 4 116614349 missense probably damaging 1.00
R7412:Nasp UTSW 4 116610588 missense possibly damaging 0.85
R7763:Nasp UTSW 4 116612033 missense probably benign 0.03
R8166:Nasp UTSW 4 116610915 missense probably benign 0.38
R8692:Nasp UTSW 4 116612083 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACTTTCAATCTTCCTTCTTTCTCCCCATAG -3'
(R):5'- TGTATATCTTTTGGTTTCCTTGGTGGTTCTTT -3'

Sequencing Primer
(F):5'- TTCTCCCCATAGAAAACCTGTTAC -3'
(R):5'- ctcaaactcagaaatccgcc -3'
Posted On2014-05-14