Incidental Mutation 'R1707:Aplp2'
ID190159
Institutional Source Beutler Lab
Gene Symbol Aplp2
Ensembl Gene ENSMUSG00000031996
Gene Nameamyloid beta (A4) precursor-like protein 2
Synonyms
MMRRC Submission 039740-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1707 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location31149557-31211815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31150919 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 692 (H692Q)
Ref Sequence ENSEMBL: ENSMUSP00000078694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072634] [ENSMUST00000079758] [ENSMUST00000217641]
Predicted Effect probably damaging
Transcript: ENSMUST00000072634
AA Change: H736Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072428
Gene: ENSMUSG00000031996
AA Change: H736Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
KU 308 361 3.52e-24 SMART
Pfam:APP_E2 365 547 1.6e-71 PFAM
low complexity region 555 568 N/A INTRINSIC
low complexity region 589 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Pfam:APP_amyloid 697 747 1.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079758
AA Change: H692Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078694
Gene: ENSMUSG00000031996
AA Change: H692Q

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
Pfam:APP_E2 307 492 2.3e-75 PFAM
low complexity region 499 512 N/A INTRINSIC
low complexity region 533 539 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:APP_amyloid 652 703 1.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216921
Predicted Effect probably damaging
Transcript: ENSMUST00000217641
AA Change: H680Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2153 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes amyloid precursor- like protein 2 (APLP2), which is a member of the APP (amyloid precursor protein) family including APP, APLP1 and APLP2. This protein is ubiquitously expressed. It contains heparin-, copper- and zinc- binding domains at the N-terminus, BPTI/Kunitz inhibitor and E2 domains in the middle region, and transmembrane and intracellular domains at the C-terminus. This protein interacts with major histocompatibility complex (MHC) class I molecules. The synergy of this protein and the APP is required to mediate neuromuscular transmission, spatial learning and synaptic plasticity. This protein has been implicated in the pathogenesis of Alzheimer's disease. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for two different targeted alleles show embryonic lethality, or viability and fertility with increased copper levels in cerebral cortex and liver. Double knockouts with App show high mortality, reduced growth, and neurological symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 160,070,802 probably benign Het
4931429P17Rik A G 13: 47,961,005 noncoding transcript Het
Acox3 T A 5: 35,601,564 I373N possibly damaging Het
Adgrb1 G T 15: 74,529,343 A63S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgap24 T C 5: 102,892,087 S297P probably benign Het
Arhgap9 C T 10: 127,328,889 P561S probably benign Het
Arhgef10l T G 4: 140,564,289 D62A probably damaging Het
Asb14 T G 14: 26,901,122 F150L probably benign Het
Atp8b3 A T 10: 80,521,801 probably null Het
Atrnl1 A G 19: 57,686,737 D686G probably benign Het
Bmpr1a A T 14: 34,425,141 probably benign Het
C330027C09Rik A C 16: 49,018,404 Q861H probably damaging Het
Cc2d2a T A 5: 43,723,688 probably null Het
Ccin T A 4: 43,983,947 I118N probably benign Het
Cd8b1 G A 6: 71,326,184 G81D probably damaging Het
Cep126 G A 9: 8,100,382 S717L probably benign Het
Colgalt2 C T 1: 152,400,363 R76W probably damaging Het
Copg1 A T 6: 87,905,210 T596S probably benign Het
Cpb1 G A 3: 20,275,491 R24W probably damaging Het
Csad T A 15: 102,179,972 D134V probably damaging Het
Dchs2 A G 3: 83,127,605 probably benign Het
Ddb2 A G 2: 91,234,209 W119R probably damaging Het
Dhx57 A T 17: 80,275,226 S317T probably damaging Het
Dlc1 A G 8: 36,937,609 V342A probably benign Het
Dpp4 G A 2: 62,359,335 probably benign Het
Dst G T 1: 34,167,646 W1005L probably damaging Het
Ehmt1 T C 2: 24,805,138 M989V probably benign Het
Gm17660 T A 5: 104,074,233 probably benign Het
Gm5422 G A 10: 31,248,462 noncoding transcript Het
Gm9944 A G 4: 144,453,263 probably benign Het
Gtf2ird2 T C 5: 134,216,987 Y696H probably damaging Het
H2-M11 T G 17: 36,548,766 V217G probably damaging Het
Hrasls A G 16: 29,228,226 K166E probably damaging Het
Hunk C T 16: 90,386,407 probably benign Het
Impg1 T C 9: 80,378,517 probably null Het
Ints11 T G 4: 155,875,198 D87E probably benign Het
Intu T A 3: 40,540,924 S21T probably benign Het
Intu C A 3: 40,683,501 D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 N45K probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klrg2 C G 6: 38,636,794 E91D possibly damaging Het
Lamc3 T C 2: 31,912,129 probably null Het
Magi2 T G 5: 20,215,493 M309R probably damaging Het
Magohb G A 6: 131,284,637 P147S probably damaging Het
Mdn1 A G 4: 32,693,504 D1043G probably damaging Het
Mtmr3 T C 11: 4,504,095 D203G probably damaging Het
Mvp C T 7: 127,001,572 V86I probably benign Het
Naip5 A T 13: 100,242,855 F226I probably damaging Het
Nasp T A 4: 116,618,936 Q51L probably damaging Het
Nf1 T A 11: 79,535,604 F1594I probably damaging Het
Nod2 A C 8: 88,670,476 E816A possibly damaging Het
Nom1 G A 5: 29,435,318 S214N probably damaging Het
Olfr168 T C 16: 19,530,177 T248A probably benign Het
Olfr25 T A 9: 38,329,901 F105I probably damaging Het
Parp14 A C 16: 35,857,849 L583R probably damaging Het
Pclo T C 5: 14,713,224 S3904P unknown Het
Pkhd1 T A 1: 20,550,840 probably benign Het
Polr1e A C 4: 45,027,469 D233A probably damaging Het
Prr29 T C 11: 106,376,683 V124A probably damaging Het
Rasgrp1 A T 2: 117,298,547 V197E probably damaging Het
Rgma A T 7: 73,417,959 T415S unknown Het
Sacs G T 14: 61,209,762 V3086L probably benign Het
Sash1 A G 10: 8,730,377 S750P probably benign Het
Sdccag3 T A 2: 26,387,606 N69Y probably damaging Het
Sema6a A T 18: 47,283,445 S372T probably benign Het
Sis A G 3: 72,909,087 probably benign Het
Skint8 T A 4: 111,939,572 V291D probably damaging Het
Slc12a8 A G 16: 33,551,007 N171S probably damaging Het
Slc25a40 G A 5: 8,440,793 probably null Het
Spag6l A T 16: 16,780,628 I333N probably benign Het
Sspo T A 6: 48,477,877 F2999L probably damaging Het
Stambpl1 A C 19: 34,238,821 T363P probably damaging Het
Tenm4 A T 7: 96,888,685 N1785Y probably damaging Het
Tln2 C T 9: 67,375,807 S293N probably benign Het
Tmed3 G A 9: 89,702,780 L141F probably damaging Het
Tmem30c G T 16: 57,266,480 T320K possibly damaging Het
Tnn T C 1: 160,145,144 Y296C probably damaging Het
Ttn C T 2: 76,790,086 A15802T probably damaging Het
Usp53 T C 3: 122,947,400 M734V probably benign Het
Vmn1r24 A G 6: 57,956,512 I7T probably benign Het
Vmn1r74 T A 7: 11,847,577 V268E probably damaging Het
Xirp1 A T 9: 120,018,775 H347Q possibly damaging Het
Other mutations in Aplp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Aplp2 APN 9 31150895 missense probably damaging 1.00
IGL02152:Aplp2 APN 9 31211651 missense unknown
IGL02309:Aplp2 APN 9 31167683 missense possibly damaging 0.80
IGL02407:Aplp2 APN 9 31158527 nonsense probably null
IGL02623:Aplp2 APN 9 31178083 splice site probably benign
IGL02737:Aplp2 APN 9 31153416 missense probably benign
IGL02958:Aplp2 APN 9 31164676 splice site probably benign
R0211:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R0279:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R1669:Aplp2 UTSW 9 31167733 intron probably benign
R1755:Aplp2 UTSW 9 31177104 missense probably damaging 1.00
R2512:Aplp2 UTSW 9 31167677 missense probably damaging 1.00
R2842:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R4031:Aplp2 UTSW 9 31157730 missense probably benign 0.00
R4115:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R5725:Aplp2 UTSW 9 31157814 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6375:Aplp2 UTSW 9 31157788 missense probably benign 0.00
R7170:Aplp2 UTSW 9 31170443 missense probably benign 0.03
R7541:Aplp2 UTSW 9 31152356 missense possibly damaging 0.82
R7584:Aplp2 UTSW 9 31157781 missense possibly damaging 0.56
R7711:Aplp2 UTSW 9 31161349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAGACTATGCCTAAAGCAGTCAG -3'
(R):5'- CTTTGAGTCCACGGGATTGGACAG -3'

Sequencing Primer
(F):5'- TGAGCCTGAAGAACTGACTTAC -3'
(R):5'- CAGGGAATAGCCTGATGTCC -3'
Posted On2014-05-14