Incidental Mutation 'R1707:Atp8b3'
ID 190167
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission 039740-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R1707 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation splice site (4525 bp from exon)
DNA Base Change (assembly) A to T at 80357635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000051773] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: I1128N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: I1128N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000051773
SMART Domains Protein: ENSMUSP00000053288
Gene: ENSMUSG00000045518

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 56 76 N/A INTRINSIC
low complexity region 98 116 N/A INTRINSIC
low complexity region 126 151 N/A INTRINSIC
low complexity region 190 227 N/A INTRINSIC
CUT 310 395 1.24e-42 SMART
HOX 411 473 1.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.6492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 159,898,372 (GRCm39) probably benign Het
4931429P17Rik A G 13: 48,114,481 (GRCm39) noncoding transcript Het
Acox3 T A 5: 35,758,908 (GRCm39) I373N possibly damaging Het
Adgrb1 G T 15: 74,401,192 (GRCm39) A63S probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aplp2 A T 9: 31,062,215 (GRCm39) H692Q probably damaging Het
Arhgap24 T C 5: 103,039,953 (GRCm39) S297P probably benign Het
Arhgap9 C T 10: 127,164,758 (GRCm39) P561S probably benign Het
Arhgef10l T G 4: 140,291,600 (GRCm39) D62A probably damaging Het
Asb14 T G 14: 26,623,079 (GRCm39) F150L probably benign Het
Atrnl1 A G 19: 57,675,169 (GRCm39) D686G probably benign Het
Bmpr1a A T 14: 34,147,098 (GRCm39) probably benign Het
Cc2d2a T A 5: 43,881,030 (GRCm39) probably null Het
Ccin T A 4: 43,983,947 (GRCm39) I118N probably benign Het
Cd8b1 G A 6: 71,303,168 (GRCm39) G81D probably damaging Het
Cep126 G A 9: 8,100,383 (GRCm39) S717L probably benign Het
Cip2a A C 16: 48,838,767 (GRCm39) Q861H probably damaging Het
Colgalt2 C T 1: 152,276,114 (GRCm39) R76W probably damaging Het
Copg1 A T 6: 87,882,192 (GRCm39) T596S probably benign Het
Cpb1 G A 3: 20,329,655 (GRCm39) R24W probably damaging Het
Csad T A 15: 102,088,407 (GRCm39) D134V probably damaging Het
Dchs2 A G 3: 83,034,912 (GRCm39) probably benign Het
Ddb2 A G 2: 91,064,554 (GRCm39) W119R probably damaging Het
Dhx57 A T 17: 80,582,655 (GRCm39) S317T probably damaging Het
Dlc1 A G 8: 37,404,763 (GRCm39) V342A probably benign Het
Dpp4 G A 2: 62,189,679 (GRCm39) probably benign Het
Dst G T 1: 34,206,727 (GRCm39) W1005L probably damaging Het
Ehmt1 T C 2: 24,695,150 (GRCm39) M989V probably benign Het
Entr1 T A 2: 26,277,618 (GRCm39) N69Y probably damaging Het
Gm5422 G A 10: 31,124,458 (GRCm39) noncoding transcript Het
Gm9944 A G 4: 144,179,833 (GRCm39) probably benign Het
Gtf2ird2 T C 5: 134,245,829 (GRCm39) Y696H probably damaging Het
H2-M11 T G 17: 36,859,658 (GRCm39) V217G probably damaging Het
Hunk C T 16: 90,183,295 (GRCm39) probably benign Het
Impg1 T C 9: 80,285,799 (GRCm39) probably null Het
Ints11 T G 4: 155,959,655 (GRCm39) D87E probably benign Het
Intu T A 3: 40,595,073 (GRCm39) S21T probably benign Het
Intu C A 3: 40,637,931 (GRCm39) D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 (GRCm39) N45K probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klrg2 C G 6: 38,613,729 (GRCm39) E91D possibly damaging Het
Lamc3 T C 2: 31,802,141 (GRCm39) probably null Het
Magi2 T G 5: 20,420,491 (GRCm39) M309R probably damaging Het
Magohb G A 6: 131,261,600 (GRCm39) P147S probably damaging Het
Mdn1 A G 4: 32,693,504 (GRCm39) D1043G probably damaging Het
Mtmr3 T C 11: 4,454,095 (GRCm39) D203G probably damaging Het
Mvp C T 7: 126,600,744 (GRCm39) V86I probably benign Het
Naip5 A T 13: 100,379,363 (GRCm39) F226I probably damaging Het
Nasp T A 4: 116,476,133 (GRCm39) Q51L probably damaging Het
Nf1 T A 11: 79,426,430 (GRCm39) F1594I probably damaging Het
Nod2 A C 8: 89,397,104 (GRCm39) E816A possibly damaging Het
Nom1 G A 5: 29,640,316 (GRCm39) S214N probably damaging Het
Or2l13b T C 16: 19,348,927 (GRCm39) T248A probably benign Het
Or8c9 T A 9: 38,241,197 (GRCm39) F105I probably damaging Het
Parp14 A C 16: 35,678,219 (GRCm39) L583R probably damaging Het
Pclo T C 5: 14,763,238 (GRCm39) S3904P unknown Het
Pkhd1 T A 1: 20,621,064 (GRCm39) probably benign Het
Plaat1 A G 16: 29,046,978 (GRCm39) K166E probably damaging Het
Polr1e A C 4: 45,027,469 (GRCm39) D233A probably damaging Het
Prr29 T C 11: 106,267,509 (GRCm39) V124A probably damaging Het
Rasgrp1 A T 2: 117,129,028 (GRCm39) V197E probably damaging Het
Rgma A T 7: 73,067,707 (GRCm39) T415S unknown Het
Sacs G T 14: 61,447,211 (GRCm39) V3086L probably benign Het
Sash1 A G 10: 8,606,141 (GRCm39) S750P probably benign Het
Scpppq1 T A 5: 104,222,099 (GRCm39) probably benign Het
Sema6a A T 18: 47,416,512 (GRCm39) S372T probably benign Het
Sis A G 3: 72,816,420 (GRCm39) probably benign Het
Skint8 T A 4: 111,796,769 (GRCm39) V291D probably damaging Het
Slc12a8 A G 16: 33,371,377 (GRCm39) N171S probably damaging Het
Slc25a40 G A 5: 8,490,793 (GRCm39) probably null Het
Spag6l A T 16: 16,598,492 (GRCm39) I333N probably benign Het
Sspo T A 6: 48,454,811 (GRCm39) F2999L probably damaging Het
Stambpl1 A C 19: 34,216,221 (GRCm39) T363P probably damaging Het
Tenm4 A T 7: 96,537,892 (GRCm39) N1785Y probably damaging Het
Tln2 C T 9: 67,283,089 (GRCm39) S293N probably benign Het
Tmed3 G A 9: 89,584,833 (GRCm39) L141F probably damaging Het
Tmem30c G T 16: 57,086,843 (GRCm39) T320K possibly damaging Het
Tnn T C 1: 159,972,714 (GRCm39) Y296C probably damaging Het
Ttn C T 2: 76,620,430 (GRCm39) A15802T probably damaging Het
Usp53 T C 3: 122,741,049 (GRCm39) M734V probably benign Het
Vmn1r24 A G 6: 57,933,497 (GRCm39) I7T probably benign Het
Vmn1r74 T A 7: 11,581,504 (GRCm39) V268E probably damaging Het
Xirp1 A T 9: 119,847,841 (GRCm39) H347Q possibly damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACTGACCAGTGTGCCTCAGATCC -3'
(R):5'- AAGACCTTCCCATTTCTGTGTGAGC -3'

Sequencing Primer
(F):5'- CAGAACCGTGTTCTTTCAGG -3'
(R):5'- TCCATTGACATCGTCTGGAG -3'
Posted On 2014-05-14