Incidental Mutation 'R1707:Mtmr3'
ID 190169
Institutional Source Beutler Lab
Gene Symbol Mtmr3
Ensembl Gene ENSMUSG00000034354
Gene Name myotubularin related protein 3
Synonyms FYVE-DSP1, 1700092A20Rik, ZFYVE10
MMRRC Submission 039740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1707 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 4430868-4544863 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4454095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 203 (D203G)
Ref Sequence ENSEMBL: ENSMUSP00000137687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040448] [ENSMUST00000109943] [ENSMUST00000123506] [ENSMUST00000128256] [ENSMUST00000130716]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040448
AA Change: D203G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049079
Gene: ENSMUSG00000034354
AA Change: D203G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109943
AA Change: D203G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105569
Gene: ENSMUSG00000034354
AA Change: D203G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 7.6e-149 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
FYVE 1072 1141 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123506
AA Change: D202G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122422
Gene: ENSMUSG00000034354
AA Change: D202G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 524 1e-138 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1108 1177 7.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128256
AA Change: D202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116315
Gene: ENSMUSG00000034354
AA Change: D202G

DomainStartEndE-ValueType
Pfam:Myotub-related 125 526 7.7e-149 PFAM
low complexity region 577 589 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
coiled coil region 1026 1057 N/A INTRINSIC
FYVE 1071 1149 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130716
AA Change: D203G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137687
Gene: ENSMUSG00000034354
AA Change: D203G

DomainStartEndE-ValueType
Pfam:Myotub-related 126 527 2.2e-148 PFAM
low complexity region 578 590 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
coiled coil region 1027 1058 N/A INTRINSIC
Meta Mutation Damage Score 0.9146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin dual specificity protein phosphatase gene family. The encoded protein is structurally similar to myotubularin but in addition contains a FYVE domain and an N-terminal PH-GRAM domain. The protein can self-associate and also form heteromers with another myotubularin related protein. The protein binds to phosphoinositide lipids through the PH-GRAM domain, and can hydrolyze phosphatidylinositol(3)-phosphate and phosphatidylinositol(3,5)-biphosphate in vitro. The encoded protein has been observed to have a perinuclear, possibly membrane-bound, distribution in cells, but it has also been found free in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in increased serum alkaline phosphatase level and, in males, impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 159,898,372 (GRCm39) probably benign Het
4931429P17Rik A G 13: 48,114,481 (GRCm39) noncoding transcript Het
Acox3 T A 5: 35,758,908 (GRCm39) I373N possibly damaging Het
Adgrb1 G T 15: 74,401,192 (GRCm39) A63S probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aplp2 A T 9: 31,062,215 (GRCm39) H692Q probably damaging Het
Arhgap24 T C 5: 103,039,953 (GRCm39) S297P probably benign Het
Arhgap9 C T 10: 127,164,758 (GRCm39) P561S probably benign Het
Arhgef10l T G 4: 140,291,600 (GRCm39) D62A probably damaging Het
Asb14 T G 14: 26,623,079 (GRCm39) F150L probably benign Het
Atp8b3 A T 10: 80,357,635 (GRCm39) probably null Het
Atrnl1 A G 19: 57,675,169 (GRCm39) D686G probably benign Het
Bmpr1a A T 14: 34,147,098 (GRCm39) probably benign Het
Cc2d2a T A 5: 43,881,030 (GRCm39) probably null Het
Ccin T A 4: 43,983,947 (GRCm39) I118N probably benign Het
Cd8b1 G A 6: 71,303,168 (GRCm39) G81D probably damaging Het
Cep126 G A 9: 8,100,383 (GRCm39) S717L probably benign Het
Cip2a A C 16: 48,838,767 (GRCm39) Q861H probably damaging Het
Colgalt2 C T 1: 152,276,114 (GRCm39) R76W probably damaging Het
Copg1 A T 6: 87,882,192 (GRCm39) T596S probably benign Het
Cpb1 G A 3: 20,329,655 (GRCm39) R24W probably damaging Het
Csad T A 15: 102,088,407 (GRCm39) D134V probably damaging Het
Dchs2 A G 3: 83,034,912 (GRCm39) probably benign Het
Ddb2 A G 2: 91,064,554 (GRCm39) W119R probably damaging Het
Dhx57 A T 17: 80,582,655 (GRCm39) S317T probably damaging Het
Dlc1 A G 8: 37,404,763 (GRCm39) V342A probably benign Het
Dpp4 G A 2: 62,189,679 (GRCm39) probably benign Het
Dst G T 1: 34,206,727 (GRCm39) W1005L probably damaging Het
Ehmt1 T C 2: 24,695,150 (GRCm39) M989V probably benign Het
Entr1 T A 2: 26,277,618 (GRCm39) N69Y probably damaging Het
Gm5422 G A 10: 31,124,458 (GRCm39) noncoding transcript Het
Gm9944 A G 4: 144,179,833 (GRCm39) probably benign Het
Gtf2ird2 T C 5: 134,245,829 (GRCm39) Y696H probably damaging Het
H2-M11 T G 17: 36,859,658 (GRCm39) V217G probably damaging Het
Hunk C T 16: 90,183,295 (GRCm39) probably benign Het
Impg1 T C 9: 80,285,799 (GRCm39) probably null Het
Ints11 T G 4: 155,959,655 (GRCm39) D87E probably benign Het
Intu T A 3: 40,595,073 (GRCm39) S21T probably benign Het
Intu C A 3: 40,637,931 (GRCm39) D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 (GRCm39) N45K probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klrg2 C G 6: 38,613,729 (GRCm39) E91D possibly damaging Het
Lamc3 T C 2: 31,802,141 (GRCm39) probably null Het
Magi2 T G 5: 20,420,491 (GRCm39) M309R probably damaging Het
Magohb G A 6: 131,261,600 (GRCm39) P147S probably damaging Het
Mdn1 A G 4: 32,693,504 (GRCm39) D1043G probably damaging Het
Mvp C T 7: 126,600,744 (GRCm39) V86I probably benign Het
Naip5 A T 13: 100,379,363 (GRCm39) F226I probably damaging Het
Nasp T A 4: 116,476,133 (GRCm39) Q51L probably damaging Het
Nf1 T A 11: 79,426,430 (GRCm39) F1594I probably damaging Het
Nod2 A C 8: 89,397,104 (GRCm39) E816A possibly damaging Het
Nom1 G A 5: 29,640,316 (GRCm39) S214N probably damaging Het
Or2l13b T C 16: 19,348,927 (GRCm39) T248A probably benign Het
Or8c9 T A 9: 38,241,197 (GRCm39) F105I probably damaging Het
Parp14 A C 16: 35,678,219 (GRCm39) L583R probably damaging Het
Pclo T C 5: 14,763,238 (GRCm39) S3904P unknown Het
Pkhd1 T A 1: 20,621,064 (GRCm39) probably benign Het
Plaat1 A G 16: 29,046,978 (GRCm39) K166E probably damaging Het
Polr1e A C 4: 45,027,469 (GRCm39) D233A probably damaging Het
Prr29 T C 11: 106,267,509 (GRCm39) V124A probably damaging Het
Rasgrp1 A T 2: 117,129,028 (GRCm39) V197E probably damaging Het
Rgma A T 7: 73,067,707 (GRCm39) T415S unknown Het
Sacs G T 14: 61,447,211 (GRCm39) V3086L probably benign Het
Sash1 A G 10: 8,606,141 (GRCm39) S750P probably benign Het
Scpppq1 T A 5: 104,222,099 (GRCm39) probably benign Het
Sema6a A T 18: 47,416,512 (GRCm39) S372T probably benign Het
Sis A G 3: 72,816,420 (GRCm39) probably benign Het
Skint8 T A 4: 111,796,769 (GRCm39) V291D probably damaging Het
Slc12a8 A G 16: 33,371,377 (GRCm39) N171S probably damaging Het
Slc25a40 G A 5: 8,490,793 (GRCm39) probably null Het
Spag6l A T 16: 16,598,492 (GRCm39) I333N probably benign Het
Sspo T A 6: 48,454,811 (GRCm39) F2999L probably damaging Het
Stambpl1 A C 19: 34,216,221 (GRCm39) T363P probably damaging Het
Tenm4 A T 7: 96,537,892 (GRCm39) N1785Y probably damaging Het
Tln2 C T 9: 67,283,089 (GRCm39) S293N probably benign Het
Tmed3 G A 9: 89,584,833 (GRCm39) L141F probably damaging Het
Tmem30c G T 16: 57,086,843 (GRCm39) T320K possibly damaging Het
Tnn T C 1: 159,972,714 (GRCm39) Y296C probably damaging Het
Ttn C T 2: 76,620,430 (GRCm39) A15802T probably damaging Het
Usp53 T C 3: 122,741,049 (GRCm39) M734V probably benign Het
Vmn1r24 A G 6: 57,933,497 (GRCm39) I7T probably benign Het
Vmn1r74 T A 7: 11,581,504 (GRCm39) V268E probably damaging Het
Xirp1 A T 9: 119,847,841 (GRCm39) H347Q possibly damaging Het
Other mutations in Mtmr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Mtmr3 APN 11 4,477,861 (GRCm39) missense probably damaging 1.00
IGL01808:Mtmr3 APN 11 4,447,404 (GRCm39) missense probably damaging 1.00
IGL01994:Mtmr3 APN 11 4,437,938 (GRCm39) missense probably benign
IGL02839:Mtmr3 APN 11 4,437,994 (GRCm39) missense probably benign 0.03
IGL02893:Mtmr3 APN 11 4,457,632 (GRCm39) missense possibly damaging 0.89
IGL03370:Mtmr3 APN 11 4,437,385 (GRCm39) missense probably damaging 1.00
capellini UTSW 11 4,447,381 (GRCm39) nonsense probably null
R0322:Mtmr3 UTSW 11 4,437,505 (GRCm39) missense possibly damaging 0.59
R0363:Mtmr3 UTSW 11 4,437,536 (GRCm39) missense probably damaging 0.99
R0655:Mtmr3 UTSW 11 4,438,610 (GRCm39) missense probably damaging 1.00
R0866:Mtmr3 UTSW 11 4,438,474 (GRCm39) missense probably benign 0.03
R1065:Mtmr3 UTSW 11 4,442,859 (GRCm39) missense probably damaging 1.00
R1417:Mtmr3 UTSW 11 4,437,923 (GRCm39) missense probably benign
R1698:Mtmr3 UTSW 11 4,442,825 (GRCm39) missense possibly damaging 0.95
R2191:Mtmr3 UTSW 11 4,449,032 (GRCm39) missense probably damaging 1.00
R2192:Mtmr3 UTSW 11 4,449,032 (GRCm39) missense probably damaging 1.00
R3956:Mtmr3 UTSW 11 4,441,138 (GRCm39) missense probably damaging 1.00
R4079:Mtmr3 UTSW 11 4,441,057 (GRCm39) missense probably damaging 1.00
R4320:Mtmr3 UTSW 11 4,437,947 (GRCm39) missense probably benign 0.39
R4577:Mtmr3 UTSW 11 4,447,375 (GRCm39) missense probably damaging 1.00
R4622:Mtmr3 UTSW 11 4,441,067 (GRCm39) missense possibly damaging 0.62
R4676:Mtmr3 UTSW 11 4,477,855 (GRCm39) missense probably benign 0.12
R4726:Mtmr3 UTSW 11 4,457,634 (GRCm39) missense probably damaging 1.00
R4781:Mtmr3 UTSW 11 4,438,435 (GRCm39) missense probably benign 0.00
R4799:Mtmr3 UTSW 11 4,437,764 (GRCm39) missense probably benign 0.12
R4810:Mtmr3 UTSW 11 4,448,046 (GRCm39) missense probably benign 0.33
R5744:Mtmr3 UTSW 11 4,437,679 (GRCm39) missense possibly damaging 0.47
R5847:Mtmr3 UTSW 11 4,432,925 (GRCm39) missense probably damaging 1.00
R5933:Mtmr3 UTSW 11 4,448,951 (GRCm39) missense probably benign
R6102:Mtmr3 UTSW 11 4,437,673 (GRCm39) missense probably damaging 0.99
R6105:Mtmr3 UTSW 11 4,435,432 (GRCm39) missense probably damaging 0.99
R6254:Mtmr3 UTSW 11 4,447,381 (GRCm39) nonsense probably null
R6443:Mtmr3 UTSW 11 4,437,358 (GRCm39) missense probably damaging 0.99
R6881:Mtmr3 UTSW 11 4,439,725 (GRCm39) missense probably benign 0.33
R6941:Mtmr3 UTSW 11 4,437,505 (GRCm39) missense possibly damaging 0.59
R6986:Mtmr3 UTSW 11 4,439,692 (GRCm39) missense probably damaging 1.00
R7045:Mtmr3 UTSW 11 4,448,896 (GRCm39) missense possibly damaging 0.94
R8469:Mtmr3 UTSW 11 4,481,223 (GRCm39) start codon destroyed probably null 0.95
R9169:Mtmr3 UTSW 11 4,437,739 (GRCm39) missense probably benign 0.00
R9452:Mtmr3 UTSW 11 4,441,037 (GRCm39) missense probably damaging 1.00
R9520:Mtmr3 UTSW 11 4,441,131 (GRCm39) missense probably damaging 1.00
R9564:Mtmr3 UTSW 11 4,440,992 (GRCm39) missense possibly damaging 0.96
R9667:Mtmr3 UTSW 11 4,470,890 (GRCm39) missense probably damaging 1.00
T0975:Mtmr3 UTSW 11 4,438,441 (GRCm39) missense probably benign
Z1176:Mtmr3 UTSW 11 4,435,913 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGCTCTGGACACAGTGAGTGC -3'
(R):5'- TGGCTGCCTATTCTGGTAAGGAGAC -3'

Sequencing Primer
(F):5'- TGTAGACACAGCTTTAGCAACAAG -3'
(R):5'- gaacatgctaggcaagcac -3'
Posted On 2014-05-14