Incidental Mutation 'R1707:Prr29'
ID 190172
Institutional Source Beutler Lab
Gene Symbol Prr29
Ensembl Gene ENSMUSG00000009210
Gene Name proline rich 29
Synonyms 2310007L24Rik
MMRRC Submission 039740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1707 (G1)
Quality Score 164
Status Not validated
Chromosome 11
Chromosomal Location 106256298-106268384 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106267509 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 124 (V124A)
Ref Sequence ENSEMBL: ENSMUSP00000140541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001055] [ENSMUST00000009354] [ENSMUST00000106813] [ENSMUST00000106816] [ENSMUST00000141146] [ENSMUST00000185986] [ENSMUST00000190795] [ENSMUST00000188561] [ENSMUST00000190268]
AlphaFold B1ARI9
Predicted Effect probably benign
Transcript: ENSMUST00000001055
SMART Domains Protein: ENSMUSP00000001055
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 8.6e-45 PFAM
Blast:IG_like 119 215 2e-36 BLAST
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000009354
AA Change: V124A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009354
Gene: ENSMUSG00000009210
AA Change: V124A

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106809
Predicted Effect probably benign
Transcript: ENSMUST00000106813
SMART Domains Protein: ENSMUSP00000102426
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 2.8e-45 PFAM
Blast:IG_like 119 161 9e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106816
AA Change: V174A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102429
Gene: ENSMUSG00000009210
AA Change: V174A

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141146
SMART Domains Protein: ENSMUSP00000118043
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ICAM_N 58 138 2.1e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185986
AA Change: V167A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140365
Gene: ENSMUSG00000009210
AA Change: V167A

DomainStartEndE-ValueType
Pfam:DUF4587 32 103 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190795
AA Change: V124A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140541
Gene: ENSMUSG00000009210
AA Change: V124A

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Predicted Effect silent
Transcript: ENSMUST00000188561
SMART Domains Protein: ENSMUSP00000140194
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 101 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190268
SMART Domains Protein: ENSMUSP00000139960
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173795
SMART Domains Protein: ENSMUSP00000133315
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
Pfam:ICAM_N 1 50 2.2e-21 PFAM
Blast:IG_like 55 151 2e-37 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 159,898,372 (GRCm39) probably benign Het
4931429P17Rik A G 13: 48,114,481 (GRCm39) noncoding transcript Het
Acox3 T A 5: 35,758,908 (GRCm39) I373N possibly damaging Het
Adgrb1 G T 15: 74,401,192 (GRCm39) A63S probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aplp2 A T 9: 31,062,215 (GRCm39) H692Q probably damaging Het
Arhgap24 T C 5: 103,039,953 (GRCm39) S297P probably benign Het
Arhgap9 C T 10: 127,164,758 (GRCm39) P561S probably benign Het
Arhgef10l T G 4: 140,291,600 (GRCm39) D62A probably damaging Het
Asb14 T G 14: 26,623,079 (GRCm39) F150L probably benign Het
Atp8b3 A T 10: 80,357,635 (GRCm39) probably null Het
Atrnl1 A G 19: 57,675,169 (GRCm39) D686G probably benign Het
Bmpr1a A T 14: 34,147,098 (GRCm39) probably benign Het
Cc2d2a T A 5: 43,881,030 (GRCm39) probably null Het
Ccin T A 4: 43,983,947 (GRCm39) I118N probably benign Het
Cd8b1 G A 6: 71,303,168 (GRCm39) G81D probably damaging Het
Cep126 G A 9: 8,100,383 (GRCm39) S717L probably benign Het
Cip2a A C 16: 48,838,767 (GRCm39) Q861H probably damaging Het
Colgalt2 C T 1: 152,276,114 (GRCm39) R76W probably damaging Het
Copg1 A T 6: 87,882,192 (GRCm39) T596S probably benign Het
Cpb1 G A 3: 20,329,655 (GRCm39) R24W probably damaging Het
Csad T A 15: 102,088,407 (GRCm39) D134V probably damaging Het
Dchs2 A G 3: 83,034,912 (GRCm39) probably benign Het
Ddb2 A G 2: 91,064,554 (GRCm39) W119R probably damaging Het
Dhx57 A T 17: 80,582,655 (GRCm39) S317T probably damaging Het
Dlc1 A G 8: 37,404,763 (GRCm39) V342A probably benign Het
Dpp4 G A 2: 62,189,679 (GRCm39) probably benign Het
Dst G T 1: 34,206,727 (GRCm39) W1005L probably damaging Het
Ehmt1 T C 2: 24,695,150 (GRCm39) M989V probably benign Het
Entr1 T A 2: 26,277,618 (GRCm39) N69Y probably damaging Het
Gm5422 G A 10: 31,124,458 (GRCm39) noncoding transcript Het
Gm9944 A G 4: 144,179,833 (GRCm39) probably benign Het
Gtf2ird2 T C 5: 134,245,829 (GRCm39) Y696H probably damaging Het
H2-M11 T G 17: 36,859,658 (GRCm39) V217G probably damaging Het
Hunk C T 16: 90,183,295 (GRCm39) probably benign Het
Impg1 T C 9: 80,285,799 (GRCm39) probably null Het
Ints11 T G 4: 155,959,655 (GRCm39) D87E probably benign Het
Intu T A 3: 40,595,073 (GRCm39) S21T probably benign Het
Intu C A 3: 40,637,931 (GRCm39) D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 (GRCm39) N45K probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klrg2 C G 6: 38,613,729 (GRCm39) E91D possibly damaging Het
Lamc3 T C 2: 31,802,141 (GRCm39) probably null Het
Magi2 T G 5: 20,420,491 (GRCm39) M309R probably damaging Het
Magohb G A 6: 131,261,600 (GRCm39) P147S probably damaging Het
Mdn1 A G 4: 32,693,504 (GRCm39) D1043G probably damaging Het
Mtmr3 T C 11: 4,454,095 (GRCm39) D203G probably damaging Het
Mvp C T 7: 126,600,744 (GRCm39) V86I probably benign Het
Naip5 A T 13: 100,379,363 (GRCm39) F226I probably damaging Het
Nasp T A 4: 116,476,133 (GRCm39) Q51L probably damaging Het
Nf1 T A 11: 79,426,430 (GRCm39) F1594I probably damaging Het
Nod2 A C 8: 89,397,104 (GRCm39) E816A possibly damaging Het
Nom1 G A 5: 29,640,316 (GRCm39) S214N probably damaging Het
Or2l13b T C 16: 19,348,927 (GRCm39) T248A probably benign Het
Or8c9 T A 9: 38,241,197 (GRCm39) F105I probably damaging Het
Parp14 A C 16: 35,678,219 (GRCm39) L583R probably damaging Het
Pclo T C 5: 14,763,238 (GRCm39) S3904P unknown Het
Pkhd1 T A 1: 20,621,064 (GRCm39) probably benign Het
Plaat1 A G 16: 29,046,978 (GRCm39) K166E probably damaging Het
Polr1e A C 4: 45,027,469 (GRCm39) D233A probably damaging Het
Rasgrp1 A T 2: 117,129,028 (GRCm39) V197E probably damaging Het
Rgma A T 7: 73,067,707 (GRCm39) T415S unknown Het
Sacs G T 14: 61,447,211 (GRCm39) V3086L probably benign Het
Sash1 A G 10: 8,606,141 (GRCm39) S750P probably benign Het
Scpppq1 T A 5: 104,222,099 (GRCm39) probably benign Het
Sema6a A T 18: 47,416,512 (GRCm39) S372T probably benign Het
Sis A G 3: 72,816,420 (GRCm39) probably benign Het
Skint8 T A 4: 111,796,769 (GRCm39) V291D probably damaging Het
Slc12a8 A G 16: 33,371,377 (GRCm39) N171S probably damaging Het
Slc25a40 G A 5: 8,490,793 (GRCm39) probably null Het
Spag6l A T 16: 16,598,492 (GRCm39) I333N probably benign Het
Sspo T A 6: 48,454,811 (GRCm39) F2999L probably damaging Het
Stambpl1 A C 19: 34,216,221 (GRCm39) T363P probably damaging Het
Tenm4 A T 7: 96,537,892 (GRCm39) N1785Y probably damaging Het
Tln2 C T 9: 67,283,089 (GRCm39) S293N probably benign Het
Tmed3 G A 9: 89,584,833 (GRCm39) L141F probably damaging Het
Tmem30c G T 16: 57,086,843 (GRCm39) T320K possibly damaging Het
Tnn T C 1: 159,972,714 (GRCm39) Y296C probably damaging Het
Ttn C T 2: 76,620,430 (GRCm39) A15802T probably damaging Het
Usp53 T C 3: 122,741,049 (GRCm39) M734V probably benign Het
Vmn1r24 A G 6: 57,933,497 (GRCm39) I7T probably benign Het
Vmn1r74 T A 7: 11,581,504 (GRCm39) V268E probably damaging Het
Xirp1 A T 9: 119,847,841 (GRCm39) H347Q possibly damaging Het
Other mutations in Prr29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Prr29 APN 11 106,266,033 (GRCm39) missense possibly damaging 0.93
Partisans UTSW 11 106,267,085 (GRCm39) missense probably damaging 0.96
R0027:Prr29 UTSW 11 106,267,102 (GRCm39) missense possibly damaging 0.81
R0193:Prr29 UTSW 11 106,267,722 (GRCm39) missense probably damaging 1.00
R1861:Prr29 UTSW 11 106,266,264 (GRCm39) missense probably damaging 1.00
R3125:Prr29 UTSW 11 106,265,711 (GRCm39) missense probably benign 0.00
R4664:Prr29 UTSW 11 106,267,159 (GRCm39) missense probably damaging 1.00
R4998:Prr29 UTSW 11 106,267,779 (GRCm39) missense probably benign 0.01
R6244:Prr29 UTSW 11 106,267,458 (GRCm39) splice site probably null
R6492:Prr29 UTSW 11 106,266,062 (GRCm39) missense probably damaging 1.00
R7069:Prr29 UTSW 11 106,267,085 (GRCm39) missense probably damaging 0.96
R7254:Prr29 UTSW 11 106,265,684 (GRCm39) start codon destroyed probably damaging 0.97
R7611:Prr29 UTSW 11 106,267,158 (GRCm39) missense probably damaging 1.00
R8023:Prr29 UTSW 11 106,267,099 (GRCm39) missense probably benign 0.45
R8039:Prr29 UTSW 11 106,267,738 (GRCm39) missense probably benign 0.10
Z1176:Prr29 UTSW 11 106,267,767 (GRCm39) missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGAGCCTTTGGTTTACCACCATCAC -3'
(R):5'- TTTGGACCCCAACGAGGAACAC -3'

Sequencing Primer
(F):5'- GTGAACCGAGAATTCAGCAC -3'
(R):5'- CACAGACTGGGACGAGGC -3'
Posted On 2014-05-14