Incidental Mutation 'R1707:Prr29'
ID190172
Institutional Source Beutler Lab
Gene Symbol Prr29
Ensembl Gene ENSMUSG00000009210
Gene Nameproline rich 29
Synonyms2310007L24Rik
MMRRC Submission 039740-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1707 (G1)
Quality Score164
Status Not validated
Chromosome11
Chromosomal Location106365472-106377558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106376683 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 124 (V124A)
Ref Sequence ENSEMBL: ENSMUSP00000140541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001055] [ENSMUST00000009354] [ENSMUST00000106813] [ENSMUST00000106816] [ENSMUST00000141146] [ENSMUST00000185986] [ENSMUST00000188561] [ENSMUST00000190268] [ENSMUST00000190795]
Predicted Effect probably benign
Transcript: ENSMUST00000001055
SMART Domains Protein: ENSMUSP00000001055
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 8.6e-45 PFAM
Blast:IG_like 119 215 2e-36 BLAST
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000009354
AA Change: V124A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009354
Gene: ENSMUSG00000009210
AA Change: V124A

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106809
Predicted Effect probably benign
Transcript: ENSMUST00000106813
SMART Domains Protein: ENSMUSP00000102426
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 2.8e-45 PFAM
Blast:IG_like 119 161 9e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106816
AA Change: V174A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102429
Gene: ENSMUSG00000009210
AA Change: V174A

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141146
SMART Domains Protein: ENSMUSP00000118043
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ICAM_N 58 138 2.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173795
SMART Domains Protein: ENSMUSP00000133315
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
Pfam:ICAM_N 1 50 2.2e-21 PFAM
Blast:IG_like 55 151 2e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185986
AA Change: V167A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140365
Gene: ENSMUSG00000009210
AA Change: V167A

DomainStartEndE-ValueType
Pfam:DUF4587 32 103 1.5e-22 PFAM
Predicted Effect silent
Transcript: ENSMUST00000188561
SMART Domains Protein: ENSMUSP00000140194
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 101 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190268
SMART Domains Protein: ENSMUSP00000139960
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 2.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190795
AA Change: V124A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140541
Gene: ENSMUSG00000009210
AA Change: V124A

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 160,070,802 probably benign Het
4931429P17Rik A G 13: 47,961,005 noncoding transcript Het
Acox3 T A 5: 35,601,564 I373N possibly damaging Het
Adgrb1 G T 15: 74,529,343 A63S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplp2 A T 9: 31,150,919 H692Q probably damaging Het
Arhgap24 T C 5: 102,892,087 S297P probably benign Het
Arhgap9 C T 10: 127,328,889 P561S probably benign Het
Arhgef10l T G 4: 140,564,289 D62A probably damaging Het
Asb14 T G 14: 26,901,122 F150L probably benign Het
Atp8b3 A T 10: 80,521,801 probably null Het
Atrnl1 A G 19: 57,686,737 D686G probably benign Het
Bmpr1a A T 14: 34,425,141 probably benign Het
C330027C09Rik A C 16: 49,018,404 Q861H probably damaging Het
Cc2d2a T A 5: 43,723,688 probably null Het
Ccin T A 4: 43,983,947 I118N probably benign Het
Cd8b1 G A 6: 71,326,184 G81D probably damaging Het
Cep126 G A 9: 8,100,382 S717L probably benign Het
Colgalt2 C T 1: 152,400,363 R76W probably damaging Het
Copg1 A T 6: 87,905,210 T596S probably benign Het
Cpb1 G A 3: 20,275,491 R24W probably damaging Het
Csad T A 15: 102,179,972 D134V probably damaging Het
Dchs2 A G 3: 83,127,605 probably benign Het
Ddb2 A G 2: 91,234,209 W119R probably damaging Het
Dhx57 A T 17: 80,275,226 S317T probably damaging Het
Dlc1 A G 8: 36,937,609 V342A probably benign Het
Dpp4 G A 2: 62,359,335 probably benign Het
Dst G T 1: 34,167,646 W1005L probably damaging Het
Ehmt1 T C 2: 24,805,138 M989V probably benign Het
Gm17660 T A 5: 104,074,233 probably benign Het
Gm5422 G A 10: 31,248,462 noncoding transcript Het
Gm9944 A G 4: 144,453,263 probably benign Het
Gtf2ird2 T C 5: 134,216,987 Y696H probably damaging Het
H2-M11 T G 17: 36,548,766 V217G probably damaging Het
Hrasls A G 16: 29,228,226 K166E probably damaging Het
Hunk C T 16: 90,386,407 probably benign Het
Impg1 T C 9: 80,378,517 probably null Het
Ints11 T G 4: 155,875,198 D87E probably benign Het
Intu T A 3: 40,540,924 S21T probably benign Het
Intu C A 3: 40,683,501 D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 N45K probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klrg2 C G 6: 38,636,794 E91D possibly damaging Het
Lamc3 T C 2: 31,912,129 probably null Het
Magi2 T G 5: 20,215,493 M309R probably damaging Het
Magohb G A 6: 131,284,637 P147S probably damaging Het
Mdn1 A G 4: 32,693,504 D1043G probably damaging Het
Mtmr3 T C 11: 4,504,095 D203G probably damaging Het
Mvp C T 7: 127,001,572 V86I probably benign Het
Naip5 A T 13: 100,242,855 F226I probably damaging Het
Nasp T A 4: 116,618,936 Q51L probably damaging Het
Nf1 T A 11: 79,535,604 F1594I probably damaging Het
Nod2 A C 8: 88,670,476 E816A possibly damaging Het
Nom1 G A 5: 29,435,318 S214N probably damaging Het
Olfr168 T C 16: 19,530,177 T248A probably benign Het
Olfr25 T A 9: 38,329,901 F105I probably damaging Het
Parp14 A C 16: 35,857,849 L583R probably damaging Het
Pclo T C 5: 14,713,224 S3904P unknown Het
Pkhd1 T A 1: 20,550,840 probably benign Het
Polr1e A C 4: 45,027,469 D233A probably damaging Het
Rasgrp1 A T 2: 117,298,547 V197E probably damaging Het
Rgma A T 7: 73,417,959 T415S unknown Het
Sacs G T 14: 61,209,762 V3086L probably benign Het
Sash1 A G 10: 8,730,377 S750P probably benign Het
Sdccag3 T A 2: 26,387,606 N69Y probably damaging Het
Sema6a A T 18: 47,283,445 S372T probably benign Het
Sis A G 3: 72,909,087 probably benign Het
Skint8 T A 4: 111,939,572 V291D probably damaging Het
Slc12a8 A G 16: 33,551,007 N171S probably damaging Het
Slc25a40 G A 5: 8,440,793 probably null Het
Spag6l A T 16: 16,780,628 I333N probably benign Het
Sspo T A 6: 48,477,877 F2999L probably damaging Het
Stambpl1 A C 19: 34,238,821 T363P probably damaging Het
Tenm4 A T 7: 96,888,685 N1785Y probably damaging Het
Tln2 C T 9: 67,375,807 S293N probably benign Het
Tmed3 G A 9: 89,702,780 L141F probably damaging Het
Tmem30c G T 16: 57,266,480 T320K possibly damaging Het
Tnn T C 1: 160,145,144 Y296C probably damaging Het
Ttn C T 2: 76,790,086 A15802T probably damaging Het
Usp53 T C 3: 122,947,400 M734V probably benign Het
Vmn1r24 A G 6: 57,956,512 I7T probably benign Het
Vmn1r74 T A 7: 11,847,577 V268E probably damaging Het
Xirp1 A T 9: 120,018,775 H347Q possibly damaging Het
Other mutations in Prr29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Prr29 APN 11 106375207 missense possibly damaging 0.93
Partisans UTSW 11 106376259 missense probably damaging 0.96
R0027:Prr29 UTSW 11 106376276 missense possibly damaging 0.81
R0193:Prr29 UTSW 11 106376896 missense probably damaging 1.00
R1861:Prr29 UTSW 11 106375438 missense probably damaging 1.00
R3125:Prr29 UTSW 11 106374885 missense probably benign 0.00
R4664:Prr29 UTSW 11 106376333 missense probably damaging 1.00
R4998:Prr29 UTSW 11 106376953 missense probably benign 0.01
R6244:Prr29 UTSW 11 106376632 intron probably null
R6492:Prr29 UTSW 11 106375236 missense probably damaging 1.00
R7069:Prr29 UTSW 11 106376259 missense probably damaging 0.96
R7254:Prr29 UTSW 11 106374858 start codon destroyed probably damaging 0.97
R7611:Prr29 UTSW 11 106376332 missense probably damaging 1.00
R8023:Prr29 UTSW 11 106376273 missense probably benign 0.45
R8039:Prr29 UTSW 11 106376912 missense probably benign 0.10
Z1176:Prr29 UTSW 11 106376941 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGAGCCTTTGGTTTACCACCATCAC -3'
(R):5'- TTTGGACCCCAACGAGGAACAC -3'

Sequencing Primer
(F):5'- GTGAACCGAGAATTCAGCAC -3'
(R):5'- CACAGACTGGGACGAGGC -3'
Posted On2014-05-14