Incidental Mutation 'R1707:Dhx57'
ID 190190
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 039740-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R1707 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80582655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 317 (S317T)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect possibly damaging
Transcript: ENSMUST00000038166
AA Change: S264T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: S264T

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: S317T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: S317T

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.0981 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 159,898,372 (GRCm39) probably benign Het
4931429P17Rik A G 13: 48,114,481 (GRCm39) noncoding transcript Het
Acox3 T A 5: 35,758,908 (GRCm39) I373N possibly damaging Het
Adgrb1 G T 15: 74,401,192 (GRCm39) A63S probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aplp2 A T 9: 31,062,215 (GRCm39) H692Q probably damaging Het
Arhgap24 T C 5: 103,039,953 (GRCm39) S297P probably benign Het
Arhgap9 C T 10: 127,164,758 (GRCm39) P561S probably benign Het
Arhgef10l T G 4: 140,291,600 (GRCm39) D62A probably damaging Het
Asb14 T G 14: 26,623,079 (GRCm39) F150L probably benign Het
Atp8b3 A T 10: 80,357,635 (GRCm39) probably null Het
Atrnl1 A G 19: 57,675,169 (GRCm39) D686G probably benign Het
Bmpr1a A T 14: 34,147,098 (GRCm39) probably benign Het
Cc2d2a T A 5: 43,881,030 (GRCm39) probably null Het
Ccin T A 4: 43,983,947 (GRCm39) I118N probably benign Het
Cd8b1 G A 6: 71,303,168 (GRCm39) G81D probably damaging Het
Cep126 G A 9: 8,100,383 (GRCm39) S717L probably benign Het
Cip2a A C 16: 48,838,767 (GRCm39) Q861H probably damaging Het
Colgalt2 C T 1: 152,276,114 (GRCm39) R76W probably damaging Het
Copg1 A T 6: 87,882,192 (GRCm39) T596S probably benign Het
Cpb1 G A 3: 20,329,655 (GRCm39) R24W probably damaging Het
Csad T A 15: 102,088,407 (GRCm39) D134V probably damaging Het
Dchs2 A G 3: 83,034,912 (GRCm39) probably benign Het
Ddb2 A G 2: 91,064,554 (GRCm39) W119R probably damaging Het
Dlc1 A G 8: 37,404,763 (GRCm39) V342A probably benign Het
Dpp4 G A 2: 62,189,679 (GRCm39) probably benign Het
Dst G T 1: 34,206,727 (GRCm39) W1005L probably damaging Het
Ehmt1 T C 2: 24,695,150 (GRCm39) M989V probably benign Het
Entr1 T A 2: 26,277,618 (GRCm39) N69Y probably damaging Het
Gm5422 G A 10: 31,124,458 (GRCm39) noncoding transcript Het
Gm9944 A G 4: 144,179,833 (GRCm39) probably benign Het
Gtf2ird2 T C 5: 134,245,829 (GRCm39) Y696H probably damaging Het
H2-M11 T G 17: 36,859,658 (GRCm39) V217G probably damaging Het
Hunk C T 16: 90,183,295 (GRCm39) probably benign Het
Impg1 T C 9: 80,285,799 (GRCm39) probably null Het
Ints11 T G 4: 155,959,655 (GRCm39) D87E probably benign Het
Intu T A 3: 40,595,073 (GRCm39) S21T probably benign Het
Intu C A 3: 40,637,931 (GRCm39) D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 (GRCm39) N45K probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klrg2 C G 6: 38,613,729 (GRCm39) E91D possibly damaging Het
Lamc3 T C 2: 31,802,141 (GRCm39) probably null Het
Magi2 T G 5: 20,420,491 (GRCm39) M309R probably damaging Het
Magohb G A 6: 131,261,600 (GRCm39) P147S probably damaging Het
Mdn1 A G 4: 32,693,504 (GRCm39) D1043G probably damaging Het
Mtmr3 T C 11: 4,454,095 (GRCm39) D203G probably damaging Het
Mvp C T 7: 126,600,744 (GRCm39) V86I probably benign Het
Naip5 A T 13: 100,379,363 (GRCm39) F226I probably damaging Het
Nasp T A 4: 116,476,133 (GRCm39) Q51L probably damaging Het
Nf1 T A 11: 79,426,430 (GRCm39) F1594I probably damaging Het
Nod2 A C 8: 89,397,104 (GRCm39) E816A possibly damaging Het
Nom1 G A 5: 29,640,316 (GRCm39) S214N probably damaging Het
Or2l13b T C 16: 19,348,927 (GRCm39) T248A probably benign Het
Or8c9 T A 9: 38,241,197 (GRCm39) F105I probably damaging Het
Parp14 A C 16: 35,678,219 (GRCm39) L583R probably damaging Het
Pclo T C 5: 14,763,238 (GRCm39) S3904P unknown Het
Pkhd1 T A 1: 20,621,064 (GRCm39) probably benign Het
Plaat1 A G 16: 29,046,978 (GRCm39) K166E probably damaging Het
Polr1e A C 4: 45,027,469 (GRCm39) D233A probably damaging Het
Prr29 T C 11: 106,267,509 (GRCm39) V124A probably damaging Het
Rasgrp1 A T 2: 117,129,028 (GRCm39) V197E probably damaging Het
Rgma A T 7: 73,067,707 (GRCm39) T415S unknown Het
Sacs G T 14: 61,447,211 (GRCm39) V3086L probably benign Het
Sash1 A G 10: 8,606,141 (GRCm39) S750P probably benign Het
Scpppq1 T A 5: 104,222,099 (GRCm39) probably benign Het
Sema6a A T 18: 47,416,512 (GRCm39) S372T probably benign Het
Sis A G 3: 72,816,420 (GRCm39) probably benign Het
Skint8 T A 4: 111,796,769 (GRCm39) V291D probably damaging Het
Slc12a8 A G 16: 33,371,377 (GRCm39) N171S probably damaging Het
Slc25a40 G A 5: 8,490,793 (GRCm39) probably null Het
Spag6l A T 16: 16,598,492 (GRCm39) I333N probably benign Het
Sspo T A 6: 48,454,811 (GRCm39) F2999L probably damaging Het
Stambpl1 A C 19: 34,216,221 (GRCm39) T363P probably damaging Het
Tenm4 A T 7: 96,537,892 (GRCm39) N1785Y probably damaging Het
Tln2 C T 9: 67,283,089 (GRCm39) S293N probably benign Het
Tmed3 G A 9: 89,584,833 (GRCm39) L141F probably damaging Het
Tmem30c G T 16: 57,086,843 (GRCm39) T320K possibly damaging Het
Tnn T C 1: 159,972,714 (GRCm39) Y296C probably damaging Het
Ttn C T 2: 76,620,430 (GRCm39) A15802T probably damaging Het
Usp53 T C 3: 122,741,049 (GRCm39) M734V probably benign Het
Vmn1r24 A G 6: 57,933,497 (GRCm39) I7T probably benign Het
Vmn1r74 T A 7: 11,581,504 (GRCm39) V268E probably damaging Het
Xirp1 A T 9: 119,847,841 (GRCm39) H347Q possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0520:Dhx57 UTSW 17 80,565,604 (GRCm39) missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACGTTCACAGGAGGAACGCTATAC -3'
(R):5'- GAGACGCTTGCTCTCAAGTCCATC -3'

Sequencing Primer
(F):5'- GACTCTTCCTCTAAAAGGGTGATCAG -3'
(R):5'- CAGAGTCTGGACCATTGGATTG -3'
Posted On 2014-05-14