Incidental Mutation 'R1707:Dhx57'
ID190190
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene NameDEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission 039740-MU
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R1707 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80238304-80290476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80275226 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 317 (S317T)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038166
AA Change: S264T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: S264T

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086555
AA Change: S317T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: S317T

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.0981 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 160,070,802 probably benign Het
4931429P17Rik A G 13: 47,961,005 noncoding transcript Het
Acox3 T A 5: 35,601,564 I373N possibly damaging Het
Adgrb1 G T 15: 74,529,343 A63S probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aplp2 A T 9: 31,150,919 H692Q probably damaging Het
Arhgap24 T C 5: 102,892,087 S297P probably benign Het
Arhgap9 C T 10: 127,328,889 P561S probably benign Het
Arhgef10l T G 4: 140,564,289 D62A probably damaging Het
Asb14 T G 14: 26,901,122 F150L probably benign Het
Atp8b3 A T 10: 80,521,801 probably null Het
Atrnl1 A G 19: 57,686,737 D686G probably benign Het
Bmpr1a A T 14: 34,425,141 probably benign Het
C330027C09Rik A C 16: 49,018,404 Q861H probably damaging Het
Cc2d2a T A 5: 43,723,688 probably null Het
Ccin T A 4: 43,983,947 I118N probably benign Het
Cd8b1 G A 6: 71,326,184 G81D probably damaging Het
Cep126 G A 9: 8,100,382 S717L probably benign Het
Colgalt2 C T 1: 152,400,363 R76W probably damaging Het
Copg1 A T 6: 87,905,210 T596S probably benign Het
Cpb1 G A 3: 20,275,491 R24W probably damaging Het
Csad T A 15: 102,179,972 D134V probably damaging Het
Dchs2 A G 3: 83,127,605 probably benign Het
Ddb2 A G 2: 91,234,209 W119R probably damaging Het
Dlc1 A G 8: 36,937,609 V342A probably benign Het
Dpp4 G A 2: 62,359,335 probably benign Het
Dst G T 1: 34,167,646 W1005L probably damaging Het
Ehmt1 T C 2: 24,805,138 M989V probably benign Het
Gm17660 T A 5: 104,074,233 probably benign Het
Gm5422 G A 10: 31,248,462 noncoding transcript Het
Gm9944 A G 4: 144,453,263 probably benign Het
Gtf2ird2 T C 5: 134,216,987 Y696H probably damaging Het
H2-M11 T G 17: 36,548,766 V217G probably damaging Het
Hrasls A G 16: 29,228,226 K166E probably damaging Het
Hunk C T 16: 90,386,407 probably benign Het
Impg1 T C 9: 80,378,517 probably null Het
Ints11 T G 4: 155,875,198 D87E probably benign Het
Intu T A 3: 40,540,924 S21T probably benign Het
Intu C A 3: 40,683,501 D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 N45K probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klrg2 C G 6: 38,636,794 E91D possibly damaging Het
Lamc3 T C 2: 31,912,129 probably null Het
Magi2 T G 5: 20,215,493 M309R probably damaging Het
Magohb G A 6: 131,284,637 P147S probably damaging Het
Mdn1 A G 4: 32,693,504 D1043G probably damaging Het
Mtmr3 T C 11: 4,504,095 D203G probably damaging Het
Mvp C T 7: 127,001,572 V86I probably benign Het
Naip5 A T 13: 100,242,855 F226I probably damaging Het
Nasp T A 4: 116,618,936 Q51L probably damaging Het
Nf1 T A 11: 79,535,604 F1594I probably damaging Het
Nod2 A C 8: 88,670,476 E816A possibly damaging Het
Nom1 G A 5: 29,435,318 S214N probably damaging Het
Olfr168 T C 16: 19,530,177 T248A probably benign Het
Olfr25 T A 9: 38,329,901 F105I probably damaging Het
Parp14 A C 16: 35,857,849 L583R probably damaging Het
Pclo T C 5: 14,713,224 S3904P unknown Het
Pkhd1 T A 1: 20,550,840 probably benign Het
Polr1e A C 4: 45,027,469 D233A probably damaging Het
Prr29 T C 11: 106,376,683 V124A probably damaging Het
Rasgrp1 A T 2: 117,298,547 V197E probably damaging Het
Rgma A T 7: 73,417,959 T415S unknown Het
Sacs G T 14: 61,209,762 V3086L probably benign Het
Sash1 A G 10: 8,730,377 S750P probably benign Het
Sdccag3 T A 2: 26,387,606 N69Y probably damaging Het
Sema6a A T 18: 47,283,445 S372T probably benign Het
Sis A G 3: 72,909,087 probably benign Het
Skint8 T A 4: 111,939,572 V291D probably damaging Het
Slc12a8 A G 16: 33,551,007 N171S probably damaging Het
Slc25a40 G A 5: 8,440,793 probably null Het
Spag6l A T 16: 16,780,628 I333N probably benign Het
Sspo T A 6: 48,477,877 F2999L probably damaging Het
Stambpl1 A C 19: 34,238,821 T363P probably damaging Het
Tenm4 A T 7: 96,888,685 N1785Y probably damaging Het
Tln2 C T 9: 67,375,807 S293N probably benign Het
Tmed3 G A 9: 89,702,780 L141F probably damaging Het
Tmem30c G T 16: 57,266,480 T320K possibly damaging Het
Tnn T C 1: 160,145,144 Y296C probably damaging Het
Ttn C T 2: 76,790,086 A15802T probably damaging Het
Usp53 T C 3: 122,947,400 M734V probably benign Het
Vmn1r24 A G 6: 57,956,512 I7T probably benign Het
Vmn1r74 T A 7: 11,847,577 V268E probably damaging Het
Xirp1 A T 9: 120,018,775 H347Q possibly damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80254379 missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACGTTCACAGGAGGAACGCTATAC -3'
(R):5'- GAGACGCTTGCTCTCAAGTCCATC -3'

Sequencing Primer
(F):5'- GACTCTTCCTCTAAAAGGGTGATCAG -3'
(R):5'- CAGAGTCTGGACCATTGGATTG -3'
Posted On2014-05-14