Mutagenetix > Incidental Mutation

Incidental Mutation 'R1707:Sema6a'

190191

Institutional Source

Beutler Lab

Gene Symbol

Sema6a

Ensembl Gene

ENSMUSG00000019647

Gene Name

sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A

Synonyms

sema, Sema6A-1, Semaq, A730020P05Rik, VIa

MMRRC Submission

039740-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1707 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47235598-47368870 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47283445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 372 (S372T)

Ref Sequence

ENSEMBL: ENSMUSP00000111109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000135790] [ENSMUST00000156422]

AlphaFold

O35464

Predicted Effect

probably benign
Transcript: ENSMUST00000019791
AA Change: S372T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: S372T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	648	670	N/A	INTRINSIC
low complexity region	932	951	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000076043
AA Change: S372T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: S372T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	593	615	N/A	INTRINSIC
low complexity region	877	896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115449
AA Change: S372T

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: S372T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	461	1.24e-168	SMART
PSI	488	543	9.57e-1	SMART
transmembrane domain	622	644	N/A	INTRINSIC
low complexity region	906	925	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123228

SMART Domains

Protein: ENSMUSP00000120249
Gene: ENSMUSG00000019647

Domain	Start	End	E-Value	Type
Blast:PSI	2	45	4e-26	BLAST
PDB:3OKY\|B	2	47	2e-26	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000135790
AA Change: S372T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: S372T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	665	687	N/A	INTRINSIC
low complexity region	949	968	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141224

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151382

Predicted Effect

probably benign
Transcript: ENSMUST00000156422
AA Change: S372T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: S372T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Sema	56	487	1.06e-185	SMART
PSI	514	569	9.57e-1	SMART
transmembrane domain	648	670	N/A	INTRINSIC
low complexity region	932	951	N/A	INTRINSIC

Meta Mutation Damage Score

0.0914

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

96% (82/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	A	T	1: 160,070,802		probably benign	Het
4931429P17Rik	A	G	13: 47,961,005		noncoding transcript	Het
Acox3	T	A	5: 35,601,564	I373N	possibly damaging	Het
Adgrb1	G	T	15: 74,529,343	A63S	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Aplp2	A	T	9: 31,150,919	H692Q	probably damaging	Het
Arhgap24	T	C	5: 102,892,087	S297P	probably benign	Het
Arhgap9	C	T	10: 127,328,889	P561S	probably benign	Het
Arhgef10l	T	G	4: 140,564,289	D62A	probably damaging	Het
Asb14	T	G	14: 26,901,122	F150L	probably benign	Het
Atp8b3	A	T	10: 80,521,801		probably null	Het
Atrnl1	A	G	19: 57,686,737	D686G	probably benign	Het
Bmpr1a	A	T	14: 34,425,141		probably benign	Het
C330027C09Rik	A	C	16: 49,018,404	Q861H	probably damaging	Het
Cc2d2a	T	A	5: 43,723,688		probably null	Het
Ccin	T	A	4: 43,983,947	I118N	probably benign	Het
Cd8b1	G	A	6: 71,326,184	G81D	probably damaging	Het
Cep126	G	A	9: 8,100,382	S717L	probably benign	Het
Colgalt2	C	T	1: 152,400,363	R76W	probably damaging	Het
Copg1	A	T	6: 87,905,210	T596S	probably benign	Het
Cpb1	G	A	3: 20,275,491	R24W	probably damaging	Het
Csad	T	A	15: 102,179,972	D134V	probably damaging	Het
Dchs2	A	G	3: 83,127,605		probably benign	Het
Ddb2	A	G	2: 91,234,209	W119R	probably damaging	Het
Dhx57	A	T	17: 80,275,226	S317T	probably damaging	Het
Dlc1	A	G	8: 36,937,609	V342A	probably benign	Het
Dpp4	G	A	2: 62,359,335		probably benign	Het
Dst	G	T	1: 34,167,646	W1005L	probably damaging	Het
Ehmt1	T	C	2: 24,805,138	M989V	probably benign	Het
Gm17660	T	A	5: 104,074,233		probably benign	Het
Gm5422	G	A	10: 31,248,462		noncoding transcript	Het
Gm9944	A	G	4: 144,453,263		probably benign	Het
Gtf2ird2	T	C	5: 134,216,987	Y696H	probably damaging	Het
H2-M11	T	G	17: 36,548,766	V217G	probably damaging	Het
Hrasls	A	G	16: 29,228,226	K166E	probably damaging	Het
Hunk	C	T	16: 90,386,407		probably benign	Het
Impg1	T	C	9: 80,378,517		probably null	Het
Ints11	T	G	4: 155,875,198	D87E	probably benign	Het
Intu	T	A	3: 40,540,924	S21T	probably benign	Het
Intu	C	A	3: 40,683,501	D472E	possibly damaging	Het
Kbtbd3	T	A	9: 4,316,985	N45K	probably benign	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klrg2	C	G	6: 38,636,794	E91D	possibly damaging	Het
Lamc3	T	C	2: 31,912,129		probably null	Het
Magi2	T	G	5: 20,215,493	M309R	probably damaging	Het
Magohb	G	A	6: 131,284,637	P147S	probably damaging	Het
Mdn1	A	G	4: 32,693,504	D1043G	probably damaging	Het
Mtmr3	T	C	11: 4,504,095	D203G	probably damaging	Het
Mvp	C	T	7: 127,001,572	V86I	probably benign	Het
Naip5	A	T	13: 100,242,855	F226I	probably damaging	Het
Nasp	T	A	4: 116,618,936	Q51L	probably damaging	Het
Nf1	T	A	11: 79,535,604	F1594I	probably damaging	Het
Nod2	A	C	8: 88,670,476	E816A	possibly damaging	Het
Nom1	G	A	5: 29,435,318	S214N	probably damaging	Het
Olfr168	T	C	16: 19,530,177	T248A	probably benign	Het
Olfr25	T	A	9: 38,329,901	F105I	probably damaging	Het
Parp14	A	C	16: 35,857,849	L583R	probably damaging	Het
Pclo	T	C	5: 14,713,224	S3904P	unknown	Het
Pkhd1	T	A	1: 20,550,840		probably benign	Het
Polr1e	A	C	4: 45,027,469	D233A	probably damaging	Het
Prr29	T	C	11: 106,376,683	V124A	probably damaging	Het
Rasgrp1	A	T	2: 117,298,547	V197E	probably damaging	Het
Rgma	A	T	7: 73,417,959	T415S	unknown	Het
Sacs	G	T	14: 61,209,762	V3086L	probably benign	Het
Sash1	A	G	10: 8,730,377	S750P	probably benign	Het
Sdccag3	T	A	2: 26,387,606	N69Y	probably damaging	Het
Sis	A	G	3: 72,909,087		probably benign	Het
Skint8	T	A	4: 111,939,572	V291D	probably damaging	Het
Slc12a8	A	G	16: 33,551,007	N171S	probably damaging	Het
Slc25a40	G	A	5: 8,440,793		probably null	Het
Spag6l	A	T	16: 16,780,628	I333N	probably benign	Het
Sspo	T	A	6: 48,477,877	F2999L	probably damaging	Het
Stambpl1	A	C	19: 34,238,821	T363P	probably damaging	Het
Tenm4	A	T	7: 96,888,685	N1785Y	probably damaging	Het
Tln2	C	T	9: 67,375,807	S293N	probably benign	Het
Tmed3	G	A	9: 89,702,780	L141F	probably damaging	Het
Tmem30c	G	T	16: 57,266,480	T320K	possibly damaging	Het
Tnn	T	C	1: 160,145,144	Y296C	probably damaging	Het
Ttn	C	T	2: 76,790,086	A15802T	probably damaging	Het
Usp53	T	C	3: 122,947,400	M734V	probably benign	Het
Vmn1r24	A	G	6: 57,956,512	I7T	probably benign	Het
Vmn1r74	T	A	7: 11,847,577	V268E	probably damaging	Het
Xirp1	A	T	9: 120,018,775	H347Q	possibly damaging	Het

Other mutations in Sema6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Sema6a	APN	18	47289975	critical splice donor site	probably null
IGL01351:Sema6a	APN	18	47281302	missense	possibly damaging	0.84
IGL01594:Sema6a	APN	18	47248817	missense	probably damaging	1.00
IGL01953:Sema6a	APN	18	47290120	nonsense	probably null
IGL02077:Sema6a	APN	18	47283398	missense	possibly damaging	0.94
IGL02632:Sema6a	APN	18	47290155	missense	probably damaging	1.00
IGL02957:Sema6a	APN	18	47249224	missense	probably damaging	1.00
IGL03013:Sema6a	APN	18	47248394	missense	probably benign	0.01
IGL03279:Sema6a	APN	18	47300090	nonsense	probably null
saphire	UTSW	18	47306429	nonsense	probably null
IGL02988:Sema6a	UTSW	18	47298214	missense	probably damaging	1.00
R0114:Sema6a	UTSW	18	47290177	missense	probably damaging	1.00
R0311:Sema6a	UTSW	18	47290045	splice site	probably null
R0312:Sema6a	UTSW	18	47290045	splice site	probably null
R0347:Sema6a	UTSW	18	47291129	missense	probably damaging	1.00
R0350:Sema6a	UTSW	18	47270718	missense	probably benign
R0366:Sema6a	UTSW	18	47290045	splice site	probably null
R0368:Sema6a	UTSW	18	47290045	splice site	probably null
R0391:Sema6a	UTSW	18	47290045	splice site	probably null
R0403:Sema6a	UTSW	18	47290045	splice site	probably null
R0466:Sema6a	UTSW	18	47290045	splice site	probably null
R0515:Sema6a	UTSW	18	47290045	splice site	probably null
R0517:Sema6a	UTSW	18	47290045	splice site	probably null
R0542:Sema6a	UTSW	18	47248576	missense	probably damaging	1.00
R0557:Sema6a	UTSW	18	47249500	missense	probably benign	0.01
R0569:Sema6a	UTSW	18	47270805	splice site	probably null
R0650:Sema6a	UTSW	18	47290045	splice site	probably null
R0689:Sema6a	UTSW	18	47290045	splice site	probably null
R0694:Sema6a	UTSW	18	47290045	splice site	probably null
R0726:Sema6a	UTSW	18	47291981	missense	probably damaging	1.00
R0741:Sema6a	UTSW	18	47290045	splice site	probably null
R0821:Sema6a	UTSW	18	47290045	splice site	probably null
R0824:Sema6a	UTSW	18	47290045	splice site	probably null
R0924:Sema6a	UTSW	18	47248492	missense	probably damaging	1.00
R1108:Sema6a	UTSW	18	47306431	missense	probably benign	0.02
R1255:Sema6a	UTSW	18	47249299	missense	probably damaging	0.98
R1422:Sema6a	UTSW	18	47306431	missense	probably benign	0.02
R1531:Sema6a	UTSW	18	47248999	missense	probably damaging	1.00
R1746:Sema6a	UTSW	18	47306349	splice site	probably benign
R1807:Sema6a	UTSW	18	47276424	missense	possibly damaging	0.85
R1974:Sema6a	UTSW	18	47270629	missense	probably benign	0.04
R1987:Sema6a	UTSW	18	47300142	missense	probably damaging	1.00
R2044:Sema6a	UTSW	18	47306429	nonsense	probably null
R3719:Sema6a	UTSW	18	47249077	missense	probably damaging	1.00
R4491:Sema6a	UTSW	18	47306457	utr 5 prime	probably benign
R4552:Sema6a	UTSW	18	47291923	missense	probably damaging	1.00
R4707:Sema6a	UTSW	18	47248712	missense	probably benign	0.43
R4710:Sema6a	UTSW	18	47270683	missense	probably benign	0.00
R4713:Sema6a	UTSW	18	47249296	missense	possibly damaging	0.79
R4963:Sema6a	UTSW	18	47298251	missense	possibly damaging	0.48
R5088:Sema6a	UTSW	18	47249129	missense	probably damaging	1.00
R5133:Sema6a	UTSW	18	47300128	missense	probably damaging	1.00
R5135:Sema6a	UTSW	18	47291172	missense	probably damaging	1.00
R5141:Sema6a	UTSW	18	47248388	missense	probably damaging	1.00
R5277:Sema6a	UTSW	18	47276544	intron	probably benign
R5551:Sema6a	UTSW	18	47248528	missense	possibly damaging	0.76
R5618:Sema6a	UTSW	18	47281948	missense	probably damaging	0.98
R5717:Sema6a	UTSW	18	47249263	missense	probably benign	0.01
R5729:Sema6a	UTSW	18	47281343	missense	probably damaging	1.00
R5779:Sema6a	UTSW	18	47248826	missense	probably damaging	1.00
R5917:Sema6a	UTSW	18	47281338	missense	probably benign	0.05
R6054:Sema6a	UTSW	18	47283403	missense	possibly damaging	0.94
R6142:Sema6a	UTSW	18	47281199	missense	probably benign	0.00
R6209:Sema6a	UTSW	18	47298302	splice site	probably null
R6307:Sema6a	UTSW	18	47249164	missense	probably damaging	1.00
R6734:Sema6a	UTSW	18	47279169	missense	probably benign	0.31
R7014:Sema6a	UTSW	18	47298217	missense	probably damaging	1.00
R7033:Sema6a	UTSW	18	47248570	missense	probably damaging	0.96
R7574:Sema6a	UTSW	18	47291164	missense	probably damaging	1.00
R8054:Sema6a	UTSW	18	47291905	missense	probably damaging	1.00
R8250:Sema6a	UTSW	18	47290115	missense	probably damaging	0.99
R8408:Sema6a	UTSW	18	47248891	missense	probably benign	0.34
R8411:Sema6a	UTSW	18	47248955	missense	probably benign	0.00
R8900:Sema6a	UTSW	18	47291115	missense	probably damaging	1.00
R9140:Sema6a	UTSW	18	47281942	missense	probably benign
R9158:Sema6a	UTSW	18	47298263	missense	probably damaging	0.98
R9488:Sema6a	UTSW	18	47304149	missense	probably damaging	1.00
R9565:Sema6a	UTSW	18	47249527	missense	probably null	1.00
R9652:Sema6a	UTSW	18	47249185	missense	probably damaging	1.00
R9732:Sema6a	UTSW	18	47248858	missense	probably damaging	0.96
X0065:Sema6a	UTSW	18	47283319	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TTTGTGGCATTTCAAAGCACCATCC -3'
(R):5'- AGCTGTTCTGGCTAAGGCTCTCTC -3'

Sequencing Primer
(F):5'- AGTCAAGGAAATCCACTTTGGATG -3'
(R):5'- CTCTCTCATGGAATGAGGAGGC -3'

Posted On

2014-05-14