Incidental Mutation 'R1707:Sema6a'
ID 190191
Institutional Source Beutler Lab
Gene Symbol Sema6a
Ensembl Gene ENSMUSG00000019647
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms VIa, Semaq, Sema6A-1, sema, A730020P05Rik
MMRRC Submission 039740-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1707 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 47378321-47504267 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 47416512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 372 (S372T)
Ref Sequence ENSEMBL: ENSMUSP00000111109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000135790] [ENSMUST00000156422]
AlphaFold O35464
Predicted Effect probably benign
Transcript: ENSMUST00000019791
AA Change: S372T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: S372T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076043
AA Change: S372T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: S372T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 593 615 N/A INTRINSIC
low complexity region 877 896 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115449
AA Change: S372T

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: S372T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 461 1.24e-168 SMART
PSI 488 543 9.57e-1 SMART
transmembrane domain 622 644 N/A INTRINSIC
low complexity region 906 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123228
SMART Domains Protein: ENSMUSP00000120249
Gene: ENSMUSG00000019647

DomainStartEndE-ValueType
Blast:PSI 2 45 4e-26 BLAST
PDB:3OKY|B 2 47 2e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135790
AA Change: S372T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: S372T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141224
Predicted Effect probably benign
Transcript: ENSMUST00000156422
AA Change: S372T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: S372T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151382
Meta Mutation Damage Score 0.0914 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A T 1: 159,898,372 (GRCm39) probably benign Het
4931429P17Rik A G 13: 48,114,481 (GRCm39) noncoding transcript Het
Acox3 T A 5: 35,758,908 (GRCm39) I373N possibly damaging Het
Adgrb1 G T 15: 74,401,192 (GRCm39) A63S probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Aplp2 A T 9: 31,062,215 (GRCm39) H692Q probably damaging Het
Arhgap24 T C 5: 103,039,953 (GRCm39) S297P probably benign Het
Arhgap9 C T 10: 127,164,758 (GRCm39) P561S probably benign Het
Arhgef10l T G 4: 140,291,600 (GRCm39) D62A probably damaging Het
Asb14 T G 14: 26,623,079 (GRCm39) F150L probably benign Het
Atp8b3 A T 10: 80,357,635 (GRCm39) probably null Het
Atrnl1 A G 19: 57,675,169 (GRCm39) D686G probably benign Het
Bmpr1a A T 14: 34,147,098 (GRCm39) probably benign Het
Cc2d2a T A 5: 43,881,030 (GRCm39) probably null Het
Ccin T A 4: 43,983,947 (GRCm39) I118N probably benign Het
Cd8b1 G A 6: 71,303,168 (GRCm39) G81D probably damaging Het
Cep126 G A 9: 8,100,383 (GRCm39) S717L probably benign Het
Cip2a A C 16: 48,838,767 (GRCm39) Q861H probably damaging Het
Colgalt2 C T 1: 152,276,114 (GRCm39) R76W probably damaging Het
Copg1 A T 6: 87,882,192 (GRCm39) T596S probably benign Het
Cpb1 G A 3: 20,329,655 (GRCm39) R24W probably damaging Het
Csad T A 15: 102,088,407 (GRCm39) D134V probably damaging Het
Dchs2 A G 3: 83,034,912 (GRCm39) probably benign Het
Ddb2 A G 2: 91,064,554 (GRCm39) W119R probably damaging Het
Dhx57 A T 17: 80,582,655 (GRCm39) S317T probably damaging Het
Dlc1 A G 8: 37,404,763 (GRCm39) V342A probably benign Het
Dpp4 G A 2: 62,189,679 (GRCm39) probably benign Het
Dst G T 1: 34,206,727 (GRCm39) W1005L probably damaging Het
Ehmt1 T C 2: 24,695,150 (GRCm39) M989V probably benign Het
Entr1 T A 2: 26,277,618 (GRCm39) N69Y probably damaging Het
Gm5422 G A 10: 31,124,458 (GRCm39) noncoding transcript Het
Gm9944 A G 4: 144,179,833 (GRCm39) probably benign Het
Gtf2ird2 T C 5: 134,245,829 (GRCm39) Y696H probably damaging Het
H2-M11 T G 17: 36,859,658 (GRCm39) V217G probably damaging Het
Hunk C T 16: 90,183,295 (GRCm39) probably benign Het
Impg1 T C 9: 80,285,799 (GRCm39) probably null Het
Ints11 T G 4: 155,959,655 (GRCm39) D87E probably benign Het
Intu T A 3: 40,595,073 (GRCm39) S21T probably benign Het
Intu C A 3: 40,637,931 (GRCm39) D472E possibly damaging Het
Kbtbd3 T A 9: 4,316,985 (GRCm39) N45K probably benign Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klrg2 C G 6: 38,613,729 (GRCm39) E91D possibly damaging Het
Lamc3 T C 2: 31,802,141 (GRCm39) probably null Het
Magi2 T G 5: 20,420,491 (GRCm39) M309R probably damaging Het
Magohb G A 6: 131,261,600 (GRCm39) P147S probably damaging Het
Mdn1 A G 4: 32,693,504 (GRCm39) D1043G probably damaging Het
Mtmr3 T C 11: 4,454,095 (GRCm39) D203G probably damaging Het
Mvp C T 7: 126,600,744 (GRCm39) V86I probably benign Het
Naip5 A T 13: 100,379,363 (GRCm39) F226I probably damaging Het
Nasp T A 4: 116,476,133 (GRCm39) Q51L probably damaging Het
Nf1 T A 11: 79,426,430 (GRCm39) F1594I probably damaging Het
Nod2 A C 8: 89,397,104 (GRCm39) E816A possibly damaging Het
Nom1 G A 5: 29,640,316 (GRCm39) S214N probably damaging Het
Or2l13b T C 16: 19,348,927 (GRCm39) T248A probably benign Het
Or8c9 T A 9: 38,241,197 (GRCm39) F105I probably damaging Het
Parp14 A C 16: 35,678,219 (GRCm39) L583R probably damaging Het
Pclo T C 5: 14,763,238 (GRCm39) S3904P unknown Het
Pkhd1 T A 1: 20,621,064 (GRCm39) probably benign Het
Plaat1 A G 16: 29,046,978 (GRCm39) K166E probably damaging Het
Polr1e A C 4: 45,027,469 (GRCm39) D233A probably damaging Het
Prr29 T C 11: 106,267,509 (GRCm39) V124A probably damaging Het
Rasgrp1 A T 2: 117,129,028 (GRCm39) V197E probably damaging Het
Rgma A T 7: 73,067,707 (GRCm39) T415S unknown Het
Sacs G T 14: 61,447,211 (GRCm39) V3086L probably benign Het
Sash1 A G 10: 8,606,141 (GRCm39) S750P probably benign Het
Scpppq1 T A 5: 104,222,099 (GRCm39) probably benign Het
Sis A G 3: 72,816,420 (GRCm39) probably benign Het
Skint8 T A 4: 111,796,769 (GRCm39) V291D probably damaging Het
Slc12a8 A G 16: 33,371,377 (GRCm39) N171S probably damaging Het
Slc25a40 G A 5: 8,490,793 (GRCm39) probably null Het
Spag6l A T 16: 16,598,492 (GRCm39) I333N probably benign Het
Sspo T A 6: 48,454,811 (GRCm39) F2999L probably damaging Het
Stambpl1 A C 19: 34,216,221 (GRCm39) T363P probably damaging Het
Tenm4 A T 7: 96,537,892 (GRCm39) N1785Y probably damaging Het
Tln2 C T 9: 67,283,089 (GRCm39) S293N probably benign Het
Tmed3 G A 9: 89,584,833 (GRCm39) L141F probably damaging Het
Tmem30c G T 16: 57,086,843 (GRCm39) T320K possibly damaging Het
Tnn T C 1: 159,972,714 (GRCm39) Y296C probably damaging Het
Ttn C T 2: 76,620,430 (GRCm39) A15802T probably damaging Het
Usp53 T C 3: 122,741,049 (GRCm39) M734V probably benign Het
Vmn1r24 A G 6: 57,933,497 (GRCm39) I7T probably benign Het
Vmn1r74 T A 7: 11,581,504 (GRCm39) V268E probably damaging Het
Xirp1 A T 9: 119,847,841 (GRCm39) H347Q possibly damaging Het
Other mutations in Sema6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Sema6a APN 18 47,423,042 (GRCm39) critical splice donor site probably null
IGL01351:Sema6a APN 18 47,414,369 (GRCm39) missense possibly damaging 0.84
IGL01594:Sema6a APN 18 47,381,884 (GRCm39) missense probably damaging 1.00
IGL01953:Sema6a APN 18 47,423,187 (GRCm39) nonsense probably null
IGL02077:Sema6a APN 18 47,416,465 (GRCm39) missense possibly damaging 0.94
IGL02632:Sema6a APN 18 47,423,222 (GRCm39) missense probably damaging 1.00
IGL02957:Sema6a APN 18 47,382,291 (GRCm39) missense probably damaging 1.00
IGL03013:Sema6a APN 18 47,381,461 (GRCm39) missense probably benign 0.01
IGL03279:Sema6a APN 18 47,433,157 (GRCm39) nonsense probably null
saphire UTSW 18 47,439,496 (GRCm39) nonsense probably null
IGL02988:Sema6a UTSW 18 47,431,281 (GRCm39) missense probably damaging 1.00
R0114:Sema6a UTSW 18 47,423,244 (GRCm39) missense probably damaging 1.00
R0311:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0312:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0347:Sema6a UTSW 18 47,424,196 (GRCm39) missense probably damaging 1.00
R0350:Sema6a UTSW 18 47,403,785 (GRCm39) missense probably benign
R0366:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0368:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0391:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0403:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0466:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0515:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0517:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0542:Sema6a UTSW 18 47,381,643 (GRCm39) missense probably damaging 1.00
R0557:Sema6a UTSW 18 47,382,567 (GRCm39) missense probably benign 0.01
R0569:Sema6a UTSW 18 47,403,872 (GRCm39) splice site probably null
R0650:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0689:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0694:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0726:Sema6a UTSW 18 47,425,048 (GRCm39) missense probably damaging 1.00
R0741:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0821:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0824:Sema6a UTSW 18 47,423,112 (GRCm39) splice site probably null
R0924:Sema6a UTSW 18 47,381,559 (GRCm39) missense probably damaging 1.00
R1108:Sema6a UTSW 18 47,439,498 (GRCm39) missense probably benign 0.02
R1255:Sema6a UTSW 18 47,382,366 (GRCm39) missense probably damaging 0.98
R1422:Sema6a UTSW 18 47,439,498 (GRCm39) missense probably benign 0.02
R1531:Sema6a UTSW 18 47,382,066 (GRCm39) missense probably damaging 1.00
R1746:Sema6a UTSW 18 47,439,416 (GRCm39) splice site probably benign
R1807:Sema6a UTSW 18 47,409,491 (GRCm39) missense possibly damaging 0.85
R1974:Sema6a UTSW 18 47,403,696 (GRCm39) missense probably benign 0.04
R1987:Sema6a UTSW 18 47,433,209 (GRCm39) missense probably damaging 1.00
R2044:Sema6a UTSW 18 47,439,496 (GRCm39) nonsense probably null
R3719:Sema6a UTSW 18 47,382,144 (GRCm39) missense probably damaging 1.00
R4491:Sema6a UTSW 18 47,439,524 (GRCm39) utr 5 prime probably benign
R4552:Sema6a UTSW 18 47,424,990 (GRCm39) missense probably damaging 1.00
R4707:Sema6a UTSW 18 47,381,779 (GRCm39) missense probably benign 0.43
R4710:Sema6a UTSW 18 47,403,750 (GRCm39) missense probably benign 0.00
R4713:Sema6a UTSW 18 47,382,363 (GRCm39) missense possibly damaging 0.79
R4963:Sema6a UTSW 18 47,431,318 (GRCm39) missense possibly damaging 0.48
R5088:Sema6a UTSW 18 47,382,196 (GRCm39) missense probably damaging 1.00
R5133:Sema6a UTSW 18 47,433,195 (GRCm39) missense probably damaging 1.00
R5135:Sema6a UTSW 18 47,424,239 (GRCm39) missense probably damaging 1.00
R5141:Sema6a UTSW 18 47,381,455 (GRCm39) missense probably damaging 1.00
R5277:Sema6a UTSW 18 47,409,611 (GRCm39) intron probably benign
R5551:Sema6a UTSW 18 47,381,595 (GRCm39) missense possibly damaging 0.76
R5618:Sema6a UTSW 18 47,415,015 (GRCm39) missense probably damaging 0.98
R5717:Sema6a UTSW 18 47,382,330 (GRCm39) missense probably benign 0.01
R5729:Sema6a UTSW 18 47,414,410 (GRCm39) missense probably damaging 1.00
R5779:Sema6a UTSW 18 47,381,893 (GRCm39) missense probably damaging 1.00
R5917:Sema6a UTSW 18 47,414,405 (GRCm39) missense probably benign 0.05
R6054:Sema6a UTSW 18 47,416,470 (GRCm39) missense possibly damaging 0.94
R6142:Sema6a UTSW 18 47,414,266 (GRCm39) missense probably benign 0.00
R6209:Sema6a UTSW 18 47,431,369 (GRCm39) splice site probably null
R6307:Sema6a UTSW 18 47,382,231 (GRCm39) missense probably damaging 1.00
R6734:Sema6a UTSW 18 47,412,236 (GRCm39) missense probably benign 0.31
R7014:Sema6a UTSW 18 47,431,284 (GRCm39) missense probably damaging 1.00
R7033:Sema6a UTSW 18 47,381,637 (GRCm39) missense probably damaging 0.96
R7574:Sema6a UTSW 18 47,424,231 (GRCm39) missense probably damaging 1.00
R8054:Sema6a UTSW 18 47,424,972 (GRCm39) missense probably damaging 1.00
R8250:Sema6a UTSW 18 47,423,182 (GRCm39) missense probably damaging 0.99
R8408:Sema6a UTSW 18 47,381,958 (GRCm39) missense probably benign 0.34
R8411:Sema6a UTSW 18 47,382,022 (GRCm39) missense probably benign 0.00
R8900:Sema6a UTSW 18 47,424,182 (GRCm39) missense probably damaging 1.00
R9140:Sema6a UTSW 18 47,415,009 (GRCm39) missense probably benign
R9158:Sema6a UTSW 18 47,431,330 (GRCm39) missense probably damaging 0.98
R9488:Sema6a UTSW 18 47,437,216 (GRCm39) missense probably damaging 1.00
R9565:Sema6a UTSW 18 47,382,594 (GRCm39) missense probably null 1.00
R9652:Sema6a UTSW 18 47,382,252 (GRCm39) missense probably damaging 1.00
R9732:Sema6a UTSW 18 47,381,925 (GRCm39) missense probably damaging 0.96
X0065:Sema6a UTSW 18 47,416,386 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTTGTGGCATTTCAAAGCACCATCC -3'
(R):5'- AGCTGTTCTGGCTAAGGCTCTCTC -3'

Sequencing Primer
(F):5'- AGTCAAGGAAATCCACTTTGGATG -3'
(R):5'- CTCTCTCATGGAATGAGGAGGC -3'
Posted On 2014-05-14