Incidental Mutation 'R1708:Myo3b'
ID190198
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission 039741-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1708 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 70245385 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 578 (K578*)
Ref Sequence ENSEMBL: ENSMUSP00000107862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably null
Transcript: ENSMUST00000060208
AA Change: K606*
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: K606*

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112243
AA Change: K578*
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: K578*

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,964,798 I4F probably benign Het
9430007A20Rik T C 4: 144,519,941 V19A probably benign Het
Abca8a A T 11: 110,053,102 S1114T probably damaging Het
Adgre1 A T 17: 57,401,974 Y55F possibly damaging Het
Alb A C 5: 90,464,051 D113A possibly damaging Het
Ankrd33b C T 15: 31,305,009 R203Q probably damaging Het
Aqp6 T C 15: 99,602,662 V156A possibly damaging Het
AU018091 T C 7: 3,156,344 S616G probably damaging Het
Cfd T A 10: 79,891,607 D68E probably benign Het
Cntn2 C T 1: 132,519,198 A725T probably damaging Het
Copg2 A C 6: 30,824,377 D373E probably damaging Het
Cyp2d11 T C 15: 82,390,432 T315A probably benign Het
Cyp2j13 G T 4: 96,062,067 N232K probably damaging Het
Cyp2j8 A T 4: 96,499,595 F210I probably damaging Het
Dnah9 G A 11: 65,915,154 T3373M probably benign Het
Eif2ak3 A G 6: 70,887,806 K549E probably damaging Het
Epha3 C T 16: 63,583,507 V744I probably damaging Het
Erich6 T C 3: 58,616,447 S669G probably benign Het
Fam90a1a A T 8: 21,961,448 K108N probably damaging Het
Fat1 G A 8: 45,024,792 V2292M probably damaging Het
Fibp T C 19: 5,463,794 C255R probably null Het
Fzd1 A G 5: 4,755,791 V597A possibly damaging Het
Gm12790 G A 4: 101,967,977 A80V possibly damaging Het
Gm2381 A T 7: 42,820,225 N158K probably benign Het
Gm6768 A G 12: 119,262,233 noncoding transcript Het
Impg2 T A 16: 56,265,078 D940E probably benign Het
Ints1 A T 5: 139,762,839 V1071E probably damaging Het
Kat5 A T 19: 5,609,479 Y44* probably null Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra6 A C 6: 130,022,714 L97* probably null Het
Ly6c2 C T 15: 75,111,620 probably null Het
Mettl7a3 A G 15: 100,335,269 N114D probably damaging Het
Mon1a G A 9: 107,898,718 E12K probably benign Het
Myrip A T 9: 120,464,774 R778S possibly damaging Het
Olfr1260 A G 2: 89,978,038 R87G probably benign Het
Olfr1362 C T 13: 21,611,070 A300T probably damaging Het
Olfr1480 T C 19: 13,529,913 V80A probably damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
Olfr503 T A 7: 108,544,574 F14L probably benign Het
Panx3 T C 9: 37,661,391 I288V probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pigc T A 1: 161,970,724 S92T probably benign Het
Pou3f2 C A 4: 22,487,255 V293L possibly damaging Het
Rbm15 A G 3: 107,331,220 S621P probably damaging Het
Rnf220 T C 4: 117,489,886 S110G probably benign Het
Rnf38 A T 4: 44,143,593 V115D probably damaging Het
Rps6ka2 A G 17: 7,277,530 H347R probably damaging Het
Ryr2 T C 13: 11,587,442 probably null Het
Sema4f G T 6: 82,917,994 P407T probably damaging Het
Setbp1 T C 18: 78,858,467 T662A probably damaging Het
Slc27a1 C A 8: 71,584,630 probably null Het
Slc41a2 T A 10: 83,233,732 I519F probably damaging Het
Sntg2 C T 12: 30,373,180 S17N possibly damaging Het
Sptb A G 12: 76,612,574 L1184P probably damaging Het
Taf5l G A 8: 124,009,770 Q21* probably null Het
Tbc1d32 A C 10: 56,151,769 S746A possibly damaging Het
Tdrd1 T G 19: 56,842,289 S251R probably benign Het
Thap7 C T 16: 17,528,950 R121Q probably benign Het
Tmem50a A G 4: 134,898,468 V146A probably benign Het
Tmprss15 T C 16: 79,054,070 I327V possibly damaging Het
Ttc23 T C 7: 67,667,176 I65T probably damaging Het
Vmn1r22 G T 6: 57,900,496 H165Q possibly damaging Het
Vopp1 C T 6: 57,762,512 R17H probably damaging Het
Vwa5a A G 9: 38,727,832 K337E probably benign Het
Wrap53 G A 11: 69,563,935 R203* probably null Het
Zfp944 T C 17: 22,339,045 Y407C probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTGCTCCCTTACCTGAAGACTC -3'
(R):5'- TGCATTTGAAAACTGTCCTGCAAGC -3'

Sequencing Primer
(F):5'- TCACCAGAGTATTAGCCTGTGAAG -3'
(R):5'- CTAGAAAacacacacacacacac -3'
Posted On2014-05-14