Incidental Mutation 'R1708:Rnf38'
ID190206
Institutional Source Beutler Lab
Gene Symbol Rnf38
Ensembl Gene ENSMUSG00000035696
Gene Namering finger protein 38
Synonyms2610202O07Rik, Oip1, 1700065B19Rik
MMRRC Submission 039741-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R1708 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location44126210-44233789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44143593 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 115 (V115D)
Ref Sequence ENSEMBL: ENSMUSP00000121329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045793] [ENSMUST00000098098] [ENSMUST00000102934] [ENSMUST00000107836] [ENSMUST00000128426] [ENSMUST00000136730] [ENSMUST00000143337] [ENSMUST00000145760]
Predicted Effect probably damaging
Transcript: ENSMUST00000045793
AA Change: V115D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038477
Gene: ENSMUSG00000035696
AA Change: V115D

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098098
AA Change: V147D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095702
Gene: ENSMUSG00000035696
AA Change: V147D

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 319 342 N/A INTRINSIC
RING 412 452 9.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102934
AA Change: V115D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099998
Gene: ENSMUSG00000035696
AA Change: V115D

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107836
AA Change: V115D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103467
Gene: ENSMUSG00000035696
AA Change: V115D

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128426
AA Change: V115D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119889
Gene: ENSMUSG00000035696
AA Change: V115D

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136730
AA Change: V115D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116642
Gene: ENSMUSG00000035696
AA Change: V115D

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143337
AA Change: V115D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122342
Gene: ENSMUSG00000035696
AA Change: V115D

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145378
Predicted Effect probably damaging
Transcript: ENSMUST00000145760
AA Change: V115D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121329
Gene: ENSMUSG00000035696
AA Change: V115D

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153384
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a coiled-coil motif and a RING-H2 motif (C3H2C2) at its carboxy-terminus. The RING motif is a zinc-binding domain found in a large set of proteins playing roles in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,964,798 I4F probably benign Het
9430007A20Rik T C 4: 144,519,941 V19A probably benign Het
Abca8a A T 11: 110,053,102 S1114T probably damaging Het
Adgre1 A T 17: 57,401,974 Y55F possibly damaging Het
Alb A C 5: 90,464,051 D113A possibly damaging Het
Ankrd33b C T 15: 31,305,009 R203Q probably damaging Het
Aqp6 T C 15: 99,602,662 V156A possibly damaging Het
AU018091 T C 7: 3,156,344 S616G probably damaging Het
Cfd T A 10: 79,891,607 D68E probably benign Het
Cntn2 C T 1: 132,519,198 A725T probably damaging Het
Copg2 A C 6: 30,824,377 D373E probably damaging Het
Cyp2d11 T C 15: 82,390,432 T315A probably benign Het
Cyp2j13 G T 4: 96,062,067 N232K probably damaging Het
Cyp2j8 A T 4: 96,499,595 F210I probably damaging Het
Dnah9 G A 11: 65,915,154 T3373M probably benign Het
Eif2ak3 A G 6: 70,887,806 K549E probably damaging Het
Epha3 C T 16: 63,583,507 V744I probably damaging Het
Erich6 T C 3: 58,616,447 S669G probably benign Het
Fam90a1a A T 8: 21,961,448 K108N probably damaging Het
Fat1 G A 8: 45,024,792 V2292M probably damaging Het
Fibp T C 19: 5,463,794 C255R probably null Het
Fzd1 A G 5: 4,755,791 V597A possibly damaging Het
Gm12790 G A 4: 101,967,977 A80V possibly damaging Het
Gm2381 A T 7: 42,820,225 N158K probably benign Het
Gm6768 A G 12: 119,262,233 noncoding transcript Het
Impg2 T A 16: 56,265,078 D940E probably benign Het
Ints1 A T 5: 139,762,839 V1071E probably damaging Het
Kat5 A T 19: 5,609,479 Y44* probably null Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra6 A C 6: 130,022,714 L97* probably null Het
Ly6c2 C T 15: 75,111,620 probably null Het
Mettl7a3 A G 15: 100,335,269 N114D probably damaging Het
Mon1a G A 9: 107,898,718 E12K probably benign Het
Myo3b A T 2: 70,245,385 K578* probably null Het
Myrip A T 9: 120,464,774 R778S possibly damaging Het
Olfr1260 A G 2: 89,978,038 R87G probably benign Het
Olfr1362 C T 13: 21,611,070 A300T probably damaging Het
Olfr1480 T C 19: 13,529,913 V80A probably damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
Olfr503 T A 7: 108,544,574 F14L probably benign Het
Panx3 T C 9: 37,661,391 I288V probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pigc T A 1: 161,970,724 S92T probably benign Het
Pou3f2 C A 4: 22,487,255 V293L possibly damaging Het
Rbm15 A G 3: 107,331,220 S621P probably damaging Het
Rnf220 T C 4: 117,489,886 S110G probably benign Het
Rps6ka2 A G 17: 7,277,530 H347R probably damaging Het
Ryr2 T C 13: 11,587,442 probably null Het
Sema4f G T 6: 82,917,994 P407T probably damaging Het
Setbp1 T C 18: 78,858,467 T662A probably damaging Het
Slc27a1 C A 8: 71,584,630 probably null Het
Slc41a2 T A 10: 83,233,732 I519F probably damaging Het
Sntg2 C T 12: 30,373,180 S17N possibly damaging Het
Sptb A G 12: 76,612,574 L1184P probably damaging Het
Taf5l G A 8: 124,009,770 Q21* probably null Het
Tbc1d32 A C 10: 56,151,769 S746A possibly damaging Het
Tdrd1 T G 19: 56,842,289 S251R probably benign Het
Thap7 C T 16: 17,528,950 R121Q probably benign Het
Tmem50a A G 4: 134,898,468 V146A probably benign Het
Tmprss15 T C 16: 79,054,070 I327V possibly damaging Het
Ttc23 T C 7: 67,667,176 I65T probably damaging Het
Vmn1r22 G T 6: 57,900,496 H165Q possibly damaging Het
Vopp1 C T 6: 57,762,512 R17H probably damaging Het
Vwa5a A G 9: 38,727,832 K337E probably benign Het
Wrap53 G A 11: 69,563,935 R203* probably null Het
Zfp944 T C 17: 22,339,045 Y407C probably damaging Het
Other mutations in Rnf38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Rnf38 APN 4 44137645 missense probably benign 0.09
IGL01992:Rnf38 APN 4 44138806 missense probably damaging 1.00
IGL02682:Rnf38 APN 4 44133745 missense probably damaging 1.00
IGL02951:Rnf38 APN 4 44129619 nonsense probably null
IGL03032:Rnf38 APN 4 44152529 missense probably damaging 0.99
IGL03326:Rnf38 APN 4 44149182 missense probably benign 0.27
R0335:Rnf38 UTSW 4 44152507 missense possibly damaging 0.59
R0336:Rnf38 UTSW 4 44152350 splice site probably benign
R1473:Rnf38 UTSW 4 44131584 missense probably benign 0.00
R1552:Rnf38 UTSW 4 44142468 splice site probably null
R1670:Rnf38 UTSW 4 44138681 missense probably damaging 0.96
R1943:Rnf38 UTSW 4 44138748 missense probably damaging 0.99
R2063:Rnf38 UTSW 4 44149098 missense probably damaging 0.99
R4348:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4352:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4353:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4618:Rnf38 UTSW 4 44142450 missense probably damaging 1.00
R4967:Rnf38 UTSW 4 44152460 missense probably damaging 1.00
R5230:Rnf38 UTSW 4 44149176 missense probably benign 0.17
R6275:Rnf38 UTSW 4 44152408 missense probably benign 0.11
R6855:Rnf38 UTSW 4 44149224 missense probably damaging 1.00
R7200:Rnf38 UTSW 4 44137620 missense probably benign 0.01
R7326:Rnf38 UTSW 4 44158989 intron probably benign
R7351:Rnf38 UTSW 4 44149102 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GACATGGACTTACTGGAGGAGGCA -3'
(R):5'- GCGAAAGTGCAATGTGAGTGTGAAT -3'

Sequencing Primer
(F):5'- CTTACTGGAGGAGGCACACTAC -3'
(R):5'- ggggaggaaagggtttattcag -3'
Posted On2014-05-14