Incidental Mutation 'R1708:Rnf220'
ID190210
Institutional Source Beutler Lab
Gene Symbol Rnf220
Ensembl Gene ENSMUSG00000028677
Gene Namering finger protein 220
Synonyms
MMRRC Submission 039741-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R1708 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location117271463-117497052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117489886 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 110 (S110G)
Ref Sequence ENSEMBL: ENSMUSP00000030439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030439]
Predicted Effect probably benign
Transcript: ENSMUST00000030439
AA Change: S110G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030439
Gene: ENSMUSG00000028677
AA Change: S110G

DomainStartEndE-ValueType
Pfam:RNF220 217 339 3.5e-38 PFAM
Pfam:RNF220 325 444 4.9e-51 PFAM
RING 514 552 1.62e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138435
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,964,798 I4F probably benign Het
9430007A20Rik T C 4: 144,519,941 V19A probably benign Het
Abca8a A T 11: 110,053,102 S1114T probably damaging Het
Adgre1 A T 17: 57,401,974 Y55F possibly damaging Het
Alb A C 5: 90,464,051 D113A possibly damaging Het
Ankrd33b C T 15: 31,305,009 R203Q probably damaging Het
Aqp6 T C 15: 99,602,662 V156A possibly damaging Het
AU018091 T C 7: 3,156,344 S616G probably damaging Het
Cfd T A 10: 79,891,607 D68E probably benign Het
Cntn2 C T 1: 132,519,198 A725T probably damaging Het
Copg2 A C 6: 30,824,377 D373E probably damaging Het
Cyp2d11 T C 15: 82,390,432 T315A probably benign Het
Cyp2j13 G T 4: 96,062,067 N232K probably damaging Het
Cyp2j8 A T 4: 96,499,595 F210I probably damaging Het
Dnah9 G A 11: 65,915,154 T3373M probably benign Het
Eif2ak3 A G 6: 70,887,806 K549E probably damaging Het
Epha3 C T 16: 63,583,507 V744I probably damaging Het
Erich6 T C 3: 58,616,447 S669G probably benign Het
Fam90a1a A T 8: 21,961,448 K108N probably damaging Het
Fat1 G A 8: 45,024,792 V2292M probably damaging Het
Fibp T C 19: 5,463,794 C255R probably null Het
Fzd1 A G 5: 4,755,791 V597A possibly damaging Het
Gm12790 G A 4: 101,967,977 A80V possibly damaging Het
Gm2381 A T 7: 42,820,225 N158K probably benign Het
Gm6768 A G 12: 119,262,233 noncoding transcript Het
Impg2 T A 16: 56,265,078 D940E probably benign Het
Ints1 A T 5: 139,762,839 V1071E probably damaging Het
Kat5 A T 19: 5,609,479 Y44* probably null Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra6 A C 6: 130,022,714 L97* probably null Het
Ly6c2 C T 15: 75,111,620 probably null Het
Mettl7a3 A G 15: 100,335,269 N114D probably damaging Het
Mon1a G A 9: 107,898,718 E12K probably benign Het
Myo3b A T 2: 70,245,385 K578* probably null Het
Myrip A T 9: 120,464,774 R778S possibly damaging Het
Olfr1260 A G 2: 89,978,038 R87G probably benign Het
Olfr1362 C T 13: 21,611,070 A300T probably damaging Het
Olfr1480 T C 19: 13,529,913 V80A probably damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
Olfr503 T A 7: 108,544,574 F14L probably benign Het
Panx3 T C 9: 37,661,391 I288V probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pigc T A 1: 161,970,724 S92T probably benign Het
Pou3f2 C A 4: 22,487,255 V293L possibly damaging Het
Rbm15 A G 3: 107,331,220 S621P probably damaging Het
Rnf38 A T 4: 44,143,593 V115D probably damaging Het
Rps6ka2 A G 17: 7,277,530 H347R probably damaging Het
Ryr2 T C 13: 11,587,442 probably null Het
Sema4f G T 6: 82,917,994 P407T probably damaging Het
Setbp1 T C 18: 78,858,467 T662A probably damaging Het
Slc27a1 C A 8: 71,584,630 probably null Het
Slc41a2 T A 10: 83,233,732 I519F probably damaging Het
Sntg2 C T 12: 30,373,180 S17N possibly damaging Het
Sptb A G 12: 76,612,574 L1184P probably damaging Het
Taf5l G A 8: 124,009,770 Q21* probably null Het
Tbc1d32 A C 10: 56,151,769 S746A possibly damaging Het
Tdrd1 T G 19: 56,842,289 S251R probably benign Het
Thap7 C T 16: 17,528,950 R121Q probably benign Het
Tmem50a A G 4: 134,898,468 V146A probably benign Het
Tmprss15 T C 16: 79,054,070 I327V possibly damaging Het
Ttc23 T C 7: 67,667,176 I65T probably damaging Het
Vmn1r22 G T 6: 57,900,496 H165Q possibly damaging Het
Vopp1 C T 6: 57,762,512 R17H probably damaging Het
Vwa5a A G 9: 38,727,832 K337E probably benign Het
Wrap53 G A 11: 69,563,935 R203* probably null Het
Zfp944 T C 17: 22,339,045 Y407C probably damaging Het
Other mutations in Rnf220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rnf220 APN 4 117307675 missense probably benign 0.02
IGL01345:Rnf220 APN 4 117273270 nonsense probably null
IGL02097:Rnf220 APN 4 117273327 missense probably benign 0.00
IGL02245:Rnf220 APN 4 117299537 splice site probably benign
IGL02366:Rnf220 APN 4 117489783 missense probably benign
IGL02725:Rnf220 APN 4 117272379 splice site probably benign
IGL02801:Rnf220 APN 4 117273251 missense probably damaging 1.00
IGL02963:Rnf220 APN 4 117490192 missense probably damaging 0.97
BB007:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
BB017:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
PIT4131001:Rnf220 UTSW 4 117277369 critical splice donor site probably null
R0041:Rnf220 UTSW 4 117273284 missense probably damaging 1.00
R0784:Rnf220 UTSW 4 117277998 splice site probably benign
R1107:Rnf220 UTSW 4 117285390 missense probably damaging 1.00
R1122:Rnf220 UTSW 4 117278080 missense probably benign 0.01
R1231:Rnf220 UTSW 4 117489884 missense probably damaging 0.98
R1794:Rnf220 UTSW 4 117307568 missense probably benign
R4488:Rnf220 UTSW 4 117489814 missense probably damaging 1.00
R4710:Rnf220 UTSW 4 117289214 unclassified probably benign
R4790:Rnf220 UTSW 4 117289055 missense probably benign 0.45
R4923:Rnf220 UTSW 4 117489600 missense possibly damaging 0.71
R5173:Rnf220 UTSW 4 117289274 start gained probably benign
R5334:Rnf220 UTSW 4 117272351 missense probably damaging 1.00
R5505:Rnf220 UTSW 4 117296091 intron probably benign
R5849:Rnf220 UTSW 4 117277612 missense possibly damaging 0.92
R7075:Rnf220 UTSW 4 117285882 missense probably benign 0.28
R7349:Rnf220 UTSW 4 117277818 missense probably damaging 0.99
R7478:Rnf220 UTSW 4 117296136 missense possibly damaging 0.94
R7541:Rnf220 UTSW 4 117489930 missense probably damaging 1.00
R7930:Rnf220 UTSW 4 117307590 missense probably damaging 0.99
R8030:Rnf220 UTSW 4 117277828 missense probably damaging 1.00
R8202:Rnf220 UTSW 4 117489873 missense probably damaging 1.00
R8701:Rnf220 UTSW 4 117489993 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACACTTCTGCGAGGCAGGCTTAC -3'
(R):5'- ACGTTCACATTCCCTTCACCAATGG -3'

Sequencing Primer
(F):5'- TCAACCTTAAGTGAGCCAGG -3'
(R):5'- ACCAATGGCTCCTACACCTTTG -3'
Posted On2014-05-14