Incidental Mutation 'R1708:Myrip'
ID 190238
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission 039741-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1708 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120293840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 778 (R778S)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect possibly damaging
Transcript: ENSMUST00000048121
AA Change: R778S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: R778S

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,941,732 (GRCm39) I4F probably benign Het
Aadacl4fm1 T C 4: 144,246,511 (GRCm39) V19A probably benign Het
Abca8a A T 11: 109,943,928 (GRCm39) S1114T probably damaging Het
Adgre1 A T 17: 57,708,974 (GRCm39) Y55F possibly damaging Het
Alb A C 5: 90,611,910 (GRCm39) D113A possibly damaging Het
Ankrd33b C T 15: 31,305,155 (GRCm39) R203Q probably damaging Het
Aqp6 T C 15: 99,500,543 (GRCm39) V156A possibly damaging Het
AU018091 T C 7: 3,206,184 (GRCm39) S616G probably damaging Het
Cfd T A 10: 79,727,441 (GRCm39) D68E probably benign Het
Cntn2 C T 1: 132,446,936 (GRCm39) A725T probably damaging Het
Copg2 A C 6: 30,801,312 (GRCm39) D373E probably damaging Het
Cyp2d11 T C 15: 82,274,633 (GRCm39) T315A probably benign Het
Cyp2j13 G T 4: 95,950,304 (GRCm39) N232K probably damaging Het
Cyp2j8 A T 4: 96,387,832 (GRCm39) F210I probably damaging Het
Dnah9 G A 11: 65,805,980 (GRCm39) T3373M probably benign Het
Eif2ak3 A G 6: 70,864,790 (GRCm39) K549E probably damaging Het
Epha3 C T 16: 63,403,870 (GRCm39) V744I probably damaging Het
Erich6 T C 3: 58,523,868 (GRCm39) S669G probably benign Het
Fam90a1a A T 8: 22,451,464 (GRCm39) K108N probably damaging Het
Fat1 G A 8: 45,477,829 (GRCm39) V2292M probably damaging Het
Fibp T C 19: 5,513,822 (GRCm39) C255R probably null Het
Fzd1 A G 5: 4,805,791 (GRCm39) V597A possibly damaging Het
Gm12790 G A 4: 101,825,174 (GRCm39) A80V possibly damaging Het
Gm2381 A T 7: 42,469,649 (GRCm39) N158K probably benign Het
Impg2 T A 16: 56,085,441 (GRCm39) D940E probably benign Het
Ints1 A T 5: 139,748,594 (GRCm39) V1071E probably damaging Het
Kat5 A T 19: 5,659,507 (GRCm39) Y44* probably null Het
Kif1c C T 11: 70,619,223 (GRCm39) L953F probably damaging Het
Klra6 A C 6: 129,999,677 (GRCm39) L97* probably null Het
Ly6c2 C T 15: 74,983,469 (GRCm39) probably null Het
Mon1a G A 9: 107,775,917 (GRCm39) E12K probably benign Het
Myo3b A T 2: 70,075,729 (GRCm39) K578* probably null Het
Ncoa4-ps A G 12: 119,225,968 (GRCm39) noncoding transcript Het
Or2w4 C T 13: 21,795,240 (GRCm39) A300T probably damaging Het
Or3a4 G A 11: 73,944,814 (GRCm39) T257I probably damaging Het
Or4c35 A G 2: 89,808,382 (GRCm39) R87G probably benign Het
Or52n4b T A 7: 108,143,781 (GRCm39) F14L probably benign Het
Or5b121 T C 19: 13,507,277 (GRCm39) V80A probably damaging Het
Panx3 T C 9: 37,572,687 (GRCm39) I288V probably benign Het
Pcdh9 G A 14: 94,125,741 (GRCm39) P143L probably damaging Het
Pigc T A 1: 161,798,293 (GRCm39) S92T probably benign Het
Pou3f2 C A 4: 22,487,255 (GRCm39) V293L possibly damaging Het
Rbm15 A G 3: 107,238,536 (GRCm39) S621P probably damaging Het
Rnf220 T C 4: 117,347,083 (GRCm39) S110G probably benign Het
Rnf38 A T 4: 44,143,593 (GRCm39) V115D probably damaging Het
Rps6ka2 A G 17: 7,544,929 (GRCm39) H347R probably damaging Het
Ryr2 T C 13: 11,602,328 (GRCm39) probably null Het
Sema4f G T 6: 82,894,975 (GRCm39) P407T probably damaging Het
Setbp1 T C 18: 78,901,682 (GRCm39) T662A probably damaging Het
Slc27a1 C A 8: 72,037,274 (GRCm39) probably null Het
Slc41a2 T A 10: 83,069,596 (GRCm39) I519F probably damaging Het
Sntg2 C T 12: 30,423,179 (GRCm39) S17N possibly damaging Het
Sptb A G 12: 76,659,348 (GRCm39) L1184P probably damaging Het
Taf5l G A 8: 124,736,509 (GRCm39) Q21* probably null Het
Tbc1d32 A C 10: 56,027,865 (GRCm39) S746A possibly damaging Het
Tdrd1 T G 19: 56,830,721 (GRCm39) S251R probably benign Het
Thap7 C T 16: 17,346,814 (GRCm39) R121Q probably benign Het
Tmem50a A G 4: 134,625,779 (GRCm39) V146A probably benign Het
Tmprss15 T C 16: 78,850,958 (GRCm39) I327V possibly damaging Het
Tmt1a3 A G 15: 100,233,150 (GRCm39) N114D probably damaging Het
Ttc23 T C 7: 67,316,924 (GRCm39) I65T probably damaging Het
Vmn1r22 G T 6: 57,877,481 (GRCm39) H165Q possibly damaging Het
Vopp1 C T 6: 57,739,497 (GRCm39) R17H probably damaging Het
Vwa5a A G 9: 38,639,128 (GRCm39) K337E probably benign Het
Wrap53 G A 11: 69,454,761 (GRCm39) R203* probably null Het
Zfp944 T C 17: 22,558,026 (GRCm39) Y407C probably damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0485:Myrip UTSW 9 120,270,443 (GRCm39) missense probably benign 0.01
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R2484:Myrip UTSW 9 120,253,685 (GRCm39) missense probably benign 0.00
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8204:Myrip UTSW 9 120,262,045 (GRCm39) critical splice donor site probably null
R8557:Myrip UTSW 9 120,246,252 (GRCm39) missense probably benign 0.32
R8853:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9106:Myrip UTSW 9 120,261,544 (GRCm39) missense probably benign 0.37
R9225:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTGTAGCGGTGGATAGACCAGTC -3'
(R):5'- ACATACCTTTCACAGGAGGGGCAG -3'

Sequencing Primer
(F):5'- aggaggtgaaggcaggag -3'
(R):5'- GGCAGGCAGTTTCCTCCTC -3'
Posted On 2014-05-14