Mutagenetix > Incidental Mutations

Incidental Mutation 'R1708:Tbc1d32'

190239

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

039741-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.879) question?

Stock #

R1708 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 56151769 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 746 (S746A)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099739
AA Change: S746A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: S746A

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217792

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219385

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009J06Rik	A	T	6: 40,964,798	I4F	probably benign	Het
9430007A20Rik	T	C	4: 144,519,941	V19A	probably benign	Het
Abca8a	A	T	11: 110,053,102	S1114T	probably damaging	Het
Adgre1	A	T	17: 57,401,974	Y55F	possibly damaging	Het
Alb	A	C	5: 90,464,051	D113A	possibly damaging	Het
Ankrd33b	C	T	15: 31,305,009	R203Q	probably damaging	Het
Aqp6	T	C	15: 99,602,662	V156A	possibly damaging	Het
AU018091	T	C	7: 3,156,344	S616G	probably damaging	Het
Cfd	T	A	10: 79,891,607	D68E	probably benign	Het
Cntn2	C	T	1: 132,519,198	A725T	probably damaging	Het
Copg2	A	C	6: 30,824,377	D373E	probably damaging	Het
Cyp2d11	T	C	15: 82,390,432	T315A	probably benign	Het
Cyp2j13	G	T	4: 96,062,067	N232K	probably damaging	Het
Cyp2j8	A	T	4: 96,499,595	F210I	probably damaging	Het
Dnah9	G	A	11: 65,915,154	T3373M	probably benign	Het
Eif2ak3	A	G	6: 70,887,806	K549E	probably damaging	Het
Epha3	C	T	16: 63,583,507	V744I	probably damaging	Het
Erich6	T	C	3: 58,616,447	S669G	probably benign	Het
Fam90a1a	A	T	8: 21,961,448	K108N	probably damaging	Het
Fat1	G	A	8: 45,024,792	V2292M	probably damaging	Het
Fibp	T	C	19: 5,463,794	C255R	probably null	Het
Fzd1	A	G	5: 4,755,791	V597A	possibly damaging	Het
Gm12790	G	A	4: 101,967,977	A80V	possibly damaging	Het
Gm2381	A	T	7: 42,820,225	N158K	probably benign	Het
Gm6768	A	G	12: 119,262,233		noncoding transcript	Het
Impg2	T	A	16: 56,265,078	D940E	probably benign	Het
Ints1	A	T	5: 139,762,839	V1071E	probably damaging	Het
Kat5	A	T	19: 5,609,479	Y44*	probably null	Het
Kif1c	C	T	11: 70,728,397	L953F	probably damaging	Het
Klra6	A	C	6: 130,022,714	L97*	probably null	Het
Ly6c2	C	T	15: 75,111,620		probably null	Het
Mettl7a3	A	G	15: 100,335,269	N114D	probably damaging	Het
Mon1a	G	A	9: 107,898,718	E12K	probably benign	Het
Myo3b	A	T	2: 70,245,385	K578*	probably null	Het
Myrip	A	T	9: 120,464,774	R778S	possibly damaging	Het
Olfr1260	A	G	2: 89,978,038	R87G	probably benign	Het
Olfr1362	C	T	13: 21,611,070	A300T	probably damaging	Het
Olfr1480	T	C	19: 13,529,913	V80A	probably damaging	Het
Olfr399	G	A	11: 74,053,988	T257I	probably damaging	Het
Olfr503	T	A	7: 108,544,574	F14L	probably benign	Het
Panx3	T	C	9: 37,661,391	I288V	probably benign	Het
Pcdh9	G	A	14: 93,888,305	P143L	probably damaging	Het
Pigc	T	A	1: 161,970,724	S92T	probably benign	Het
Pou3f2	C	A	4: 22,487,255	V293L	possibly damaging	Het
Rbm15	A	G	3: 107,331,220	S621P	probably damaging	Het
Rnf220	T	C	4: 117,489,886	S110G	probably benign	Het
Rnf38	A	T	4: 44,143,593	V115D	probably damaging	Het
Rps6ka2	A	G	17: 7,277,530	H347R	probably damaging	Het
Ryr2	T	C	13: 11,587,442		probably null	Het
Sema4f	G	T	6: 82,917,994	P407T	probably damaging	Het
Setbp1	T	C	18: 78,858,467	T662A	probably damaging	Het
Slc27a1	C	A	8: 71,584,630		probably null	Het
Slc41a2	T	A	10: 83,233,732	I519F	probably damaging	Het
Sntg2	C	T	12: 30,373,180	S17N	possibly damaging	Het
Sptb	A	G	12: 76,612,574	L1184P	probably damaging	Het
Taf5l	G	A	8: 124,009,770	Q21*	probably null	Het
Tdrd1	T	G	19: 56,842,289	S251R	probably benign	Het
Thap7	C	T	16: 17,528,950	R121Q	probably benign	Het
Tmem50a	A	G	4: 134,898,468	V146A	probably benign	Het
Tmprss15	T	C	16: 79,054,070	I327V	possibly damaging	Het
Ttc23	T	C	7: 67,667,176	I65T	probably damaging	Het
Vmn1r22	G	T	6: 57,900,496	H165Q	possibly damaging	Het
Vopp1	C	T	6: 57,762,512	R17H	probably damaging	Het
Vwa5a	A	G	9: 38,727,832	K337E	probably benign	Het
Wrap53	G	A	11: 69,563,935	R203*	probably null	Het
Zfp944	T	C	17: 22,339,045	Y407C	probably damaging	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCAGGCATCCAAGGAATTTGTTCACTTA -3'
(R):5'- GGTTTCATTGTTCTGTGCTGTCATCACT -3'

Sequencing Primer
(F):5'- acatctacaacacaaattccacatac -3'
(R):5'- CTGTGCTGTCATCACTTAGAAG -3'

Posted On

2014-05-14