Incidental Mutation 'R1708:Gm6768'
ID190249
Institutional Source Beutler Lab
Gene Symbol Gm6768
Ensembl Gene ENSMUSG00000021908
Gene Namepredicted gene 6768
Synonyms
MMRRC Submission 039741-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1708 (G1)
Quality Score201
Status Not validated
Chromosome12
Chromosomal Location119260934-119264272 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 119262233 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000022467
SMART Domains Protein: ENSMUSP00000136708
Gene: ENSMUSG00000021908

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,964,798 I4F probably benign Het
9430007A20Rik T C 4: 144,519,941 V19A probably benign Het
Abca8a A T 11: 110,053,102 S1114T probably damaging Het
Adgre1 A T 17: 57,401,974 Y55F possibly damaging Het
Alb A C 5: 90,464,051 D113A possibly damaging Het
Ankrd33b C T 15: 31,305,009 R203Q probably damaging Het
Aqp6 T C 15: 99,602,662 V156A possibly damaging Het
AU018091 T C 7: 3,156,344 S616G probably damaging Het
Cfd T A 10: 79,891,607 D68E probably benign Het
Cntn2 C T 1: 132,519,198 A725T probably damaging Het
Copg2 A C 6: 30,824,377 D373E probably damaging Het
Cyp2d11 T C 15: 82,390,432 T315A probably benign Het
Cyp2j13 G T 4: 96,062,067 N232K probably damaging Het
Cyp2j8 A T 4: 96,499,595 F210I probably damaging Het
Dnah9 G A 11: 65,915,154 T3373M probably benign Het
Eif2ak3 A G 6: 70,887,806 K549E probably damaging Het
Epha3 C T 16: 63,583,507 V744I probably damaging Het
Erich6 T C 3: 58,616,447 S669G probably benign Het
Fam90a1a A T 8: 21,961,448 K108N probably damaging Het
Fat1 G A 8: 45,024,792 V2292M probably damaging Het
Fibp T C 19: 5,463,794 C255R probably null Het
Fzd1 A G 5: 4,755,791 V597A possibly damaging Het
Gm12790 G A 4: 101,967,977 A80V possibly damaging Het
Gm2381 A T 7: 42,820,225 N158K probably benign Het
Impg2 T A 16: 56,265,078 D940E probably benign Het
Ints1 A T 5: 139,762,839 V1071E probably damaging Het
Kat5 A T 19: 5,609,479 Y44* probably null Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra6 A C 6: 130,022,714 L97* probably null Het
Ly6c2 C T 15: 75,111,620 probably null Het
Mettl7a3 A G 15: 100,335,269 N114D probably damaging Het
Mon1a G A 9: 107,898,718 E12K probably benign Het
Myo3b A T 2: 70,245,385 K578* probably null Het
Myrip A T 9: 120,464,774 R778S possibly damaging Het
Olfr1260 A G 2: 89,978,038 R87G probably benign Het
Olfr1362 C T 13: 21,611,070 A300T probably damaging Het
Olfr1480 T C 19: 13,529,913 V80A probably damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
Olfr503 T A 7: 108,544,574 F14L probably benign Het
Panx3 T C 9: 37,661,391 I288V probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pigc T A 1: 161,970,724 S92T probably benign Het
Pou3f2 C A 4: 22,487,255 V293L possibly damaging Het
Rbm15 A G 3: 107,331,220 S621P probably damaging Het
Rnf220 T C 4: 117,489,886 S110G probably benign Het
Rnf38 A T 4: 44,143,593 V115D probably damaging Het
Rps6ka2 A G 17: 7,277,530 H347R probably damaging Het
Ryr2 T C 13: 11,587,442 probably null Het
Sema4f G T 6: 82,917,994 P407T probably damaging Het
Setbp1 T C 18: 78,858,467 T662A probably damaging Het
Slc27a1 C A 8: 71,584,630 probably null Het
Slc41a2 T A 10: 83,233,732 I519F probably damaging Het
Sntg2 C T 12: 30,373,180 S17N possibly damaging Het
Sptb A G 12: 76,612,574 L1184P probably damaging Het
Taf5l G A 8: 124,009,770 Q21* probably null Het
Tbc1d32 A C 10: 56,151,769 S746A possibly damaging Het
Tdrd1 T G 19: 56,842,289 S251R probably benign Het
Thap7 C T 16: 17,528,950 R121Q probably benign Het
Tmem50a A G 4: 134,898,468 V146A probably benign Het
Tmprss15 T C 16: 79,054,070 I327V possibly damaging Het
Ttc23 T C 7: 67,667,176 I65T probably damaging Het
Vmn1r22 G T 6: 57,900,496 H165Q possibly damaging Het
Vopp1 C T 6: 57,762,512 R17H probably damaging Het
Vwa5a A G 9: 38,727,832 K337E probably benign Het
Wrap53 G A 11: 69,563,935 R203* probably null Het
Zfp944 T C 17: 22,339,045 Y407C probably damaging Het
Other mutations in Gm6768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Gm6768 APN 12 119262496 exon noncoding transcript
R0683:Gm6768 UTSW 12 119261078 exon noncoding transcript
R1186:Gm6768 UTSW 12 119261471 exon noncoding transcript
R1485:Gm6768 UTSW 12 119261050 exon noncoding transcript
R1800:Gm6768 UTSW 12 119261771 exon noncoding transcript
R2280:Gm6768 UTSW 12 119262838 exon noncoding transcript
R4827:Gm6768 UTSW 12 119261794 exon noncoding transcript
R4922:Gm6768 UTSW 12 119262517 exon noncoding transcript
R5183:Gm6768 UTSW 12 119261288 exon noncoding transcript
R5562:Gm6768 UTSW 12 119262222 exon noncoding transcript
R5752:Gm6768 UTSW 12 119262614 exon noncoding transcript
R6033:Gm6768 UTSW 12 119261740 exon noncoding transcript
R6033:Gm6768 UTSW 12 119261740 exon noncoding transcript
R6084:Gm6768 UTSW 12 119261651 exon noncoding transcript
R6151:Gm6768 UTSW 12 119261106 exon noncoding transcript
X0024:Gm6768 UTSW 12 119261684 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCCAGGTGTTCAGAGAGCCCTAC -3'
(R):5'- CAGCAATTCTAGCAGGAGCCATAGC -3'

Sequencing Primer
(F):5'- TGTTCAGAGAGCCCTACAATGTG -3'
(R):5'- GAGCCATAGCCTTGGGTG -3'
Posted On2014-05-14