Incidental Mutation 'R1708:Zfp944'
ID190267
Institutional Source Beutler Lab
Gene Symbol Zfp944
Ensembl Gene ENSMUSG00000033972
Gene Namezinc finger protein 944
Synonyms6330416L07Rik
MMRRC Submission 039741-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R1708 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location22337989-22361400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22339045 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 407 (Y407C)
Ref Sequence ENSEMBL: ENSMUSP00000111197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115535]
Predicted Effect probably damaging
Transcript: ENSMUST00000115535
AA Change: Y407C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111197
Gene: ENSMUSG00000033972
AA Change: Y407C

DomainStartEndE-ValueType
KRAB 13 76 2.08e-21 SMART
ZnF_C2H2 183 205 1.01e-1 SMART
ZnF_C2H2 211 233 1.07e0 SMART
ZnF_C2H2 239 261 1.95e-3 SMART
ZnF_C2H2 267 289 1.22e-4 SMART
ZnF_C2H2 295 317 2.24e-3 SMART
ZnF_C2H2 323 345 1.82e-3 SMART
ZnF_C2H2 351 373 5.99e-4 SMART
ZnF_C2H2 379 401 4.79e-3 SMART
ZnF_C2H2 407 429 2.99e-4 SMART
ZnF_C2H2 435 457 4.17e-3 SMART
ZnF_C2H2 463 485 1.36e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,964,798 I4F probably benign Het
9430007A20Rik T C 4: 144,519,941 V19A probably benign Het
Abca8a A T 11: 110,053,102 S1114T probably damaging Het
Adgre1 A T 17: 57,401,974 Y55F possibly damaging Het
Alb A C 5: 90,464,051 D113A possibly damaging Het
Ankrd33b C T 15: 31,305,009 R203Q probably damaging Het
Aqp6 T C 15: 99,602,662 V156A possibly damaging Het
AU018091 T C 7: 3,156,344 S616G probably damaging Het
Cfd T A 10: 79,891,607 D68E probably benign Het
Cntn2 C T 1: 132,519,198 A725T probably damaging Het
Copg2 A C 6: 30,824,377 D373E probably damaging Het
Cyp2d11 T C 15: 82,390,432 T315A probably benign Het
Cyp2j13 G T 4: 96,062,067 N232K probably damaging Het
Cyp2j8 A T 4: 96,499,595 F210I probably damaging Het
Dnah9 G A 11: 65,915,154 T3373M probably benign Het
Eif2ak3 A G 6: 70,887,806 K549E probably damaging Het
Epha3 C T 16: 63,583,507 V744I probably damaging Het
Erich6 T C 3: 58,616,447 S669G probably benign Het
Fam90a1a A T 8: 21,961,448 K108N probably damaging Het
Fat1 G A 8: 45,024,792 V2292M probably damaging Het
Fibp T C 19: 5,463,794 C255R probably null Het
Fzd1 A G 5: 4,755,791 V597A possibly damaging Het
Gm12790 G A 4: 101,967,977 A80V possibly damaging Het
Gm2381 A T 7: 42,820,225 N158K probably benign Het
Gm6768 A G 12: 119,262,233 noncoding transcript Het
Impg2 T A 16: 56,265,078 D940E probably benign Het
Ints1 A T 5: 139,762,839 V1071E probably damaging Het
Kat5 A T 19: 5,609,479 Y44* probably null Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra6 A C 6: 130,022,714 L97* probably null Het
Ly6c2 C T 15: 75,111,620 probably null Het
Mettl7a3 A G 15: 100,335,269 N114D probably damaging Het
Mon1a G A 9: 107,898,718 E12K probably benign Het
Myo3b A T 2: 70,245,385 K578* probably null Het
Myrip A T 9: 120,464,774 R778S possibly damaging Het
Olfr1260 A G 2: 89,978,038 R87G probably benign Het
Olfr1362 C T 13: 21,611,070 A300T probably damaging Het
Olfr1480 T C 19: 13,529,913 V80A probably damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
Olfr503 T A 7: 108,544,574 F14L probably benign Het
Panx3 T C 9: 37,661,391 I288V probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pigc T A 1: 161,970,724 S92T probably benign Het
Pou3f2 C A 4: 22,487,255 V293L possibly damaging Het
Rbm15 A G 3: 107,331,220 S621P probably damaging Het
Rnf220 T C 4: 117,489,886 S110G probably benign Het
Rnf38 A T 4: 44,143,593 V115D probably damaging Het
Rps6ka2 A G 17: 7,277,530 H347R probably damaging Het
Ryr2 T C 13: 11,587,442 probably null Het
Sema4f G T 6: 82,917,994 P407T probably damaging Het
Setbp1 T C 18: 78,858,467 T662A probably damaging Het
Slc27a1 C A 8: 71,584,630 probably null Het
Slc41a2 T A 10: 83,233,732 I519F probably damaging Het
Sntg2 C T 12: 30,373,180 S17N possibly damaging Het
Sptb A G 12: 76,612,574 L1184P probably damaging Het
Taf5l G A 8: 124,009,770 Q21* probably null Het
Tbc1d32 A C 10: 56,151,769 S746A possibly damaging Het
Tdrd1 T G 19: 56,842,289 S251R probably benign Het
Thap7 C T 16: 17,528,950 R121Q probably benign Het
Tmem50a A G 4: 134,898,468 V146A probably benign Het
Tmprss15 T C 16: 79,054,070 I327V possibly damaging Het
Ttc23 T C 7: 67,667,176 I65T probably damaging Het
Vmn1r22 G T 6: 57,900,496 H165Q possibly damaging Het
Vopp1 C T 6: 57,762,512 R17H probably damaging Het
Vwa5a A G 9: 38,727,832 K337E probably benign Het
Wrap53 G A 11: 69,563,935 R203* probably null Het
Other mutations in Zfp944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Zfp944 APN 17 22339205 missense probably benign 0.10
IGL00917:Zfp944 APN 17 22339784 missense probably benign 0.00
IGL01093:Zfp944 APN 17 22343634 splice site probably benign
IGL02113:Zfp944 APN 17 22339066 missense possibly damaging 0.88
IGL02694:Zfp944 APN 17 22339918 missense probably benign 0.05
IGL03135:Zfp944 APN 17 22339756 missense probably benign 0.00
IGL03172:Zfp944 APN 17 22340037 missense probably damaging 0.98
R0121:Zfp944 UTSW 17 22339268 missense possibly damaging 0.69
R0336:Zfp944 UTSW 17 22339028 missense probably damaging 1.00
R0755:Zfp944 UTSW 17 22339908 missense possibly damaging 0.63
R1536:Zfp944 UTSW 17 22339716 nonsense probably null
R1886:Zfp944 UTSW 17 22339979 missense probably benign 0.04
R1928:Zfp944 UTSW 17 22341084 missense probably damaging 0.96
R1950:Zfp944 UTSW 17 22339700 missense probably benign 0.16
R2075:Zfp944 UTSW 17 22339197 nonsense probably null
R2101:Zfp944 UTSW 17 22339828 missense probably benign 0.41
R2433:Zfp944 UTSW 17 22339212 nonsense probably null
R4698:Zfp944 UTSW 17 22339199 missense probably damaging 1.00
R4986:Zfp944 UTSW 17 22339230 missense probably damaging 1.00
R6451:Zfp944 UTSW 17 22338865 missense probably benign 0.40
R6566:Zfp944 UTSW 17 22339745 missense possibly damaging 0.96
R6752:Zfp944 UTSW 17 22339519 missense probably benign 0.01
R7064:Zfp944 UTSW 17 22339579 missense probably damaging 1.00
R8193:Zfp944 UTSW 17 22339880 nonsense probably null
R8323:Zfp944 UTSW 17 22339254 missense probably benign
R8328:Zfp944 UTSW 17 22339724 nonsense probably null
R8902:Zfp944 UTSW 17 22339780 missense probably benign 0.41
R8915:Zfp944 UTSW 17 22339526 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAATACATGCCACATGTTTTCCAGCAG -3'
(R):5'- ACTCGGGCTGAAACAAACCAATAGTg -3'

Sequencing Primer
(F):5'- gggtttgtgtcatttgtttcatttg -3'
(R):5'- actgaatgtgacaaatgctttacc -3'
Posted On2014-05-14