Incidental Mutation 'R1708:Olfr1480'
ID190273
Institutional Source Beutler Lab
Gene Symbol Olfr1480
Ensembl Gene ENSMUSG00000095484
Gene Nameolfactory receptor 1480
SynonymsMOR202-44, GA_x6K02T2RE5P-3862389-3863336
MMRRC Submission 039741-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R1708 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13527913-13531275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13529913 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 80 (V80A)
Ref Sequence ENSEMBL: ENSMUSP00000147226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072219] [ENSMUST00000207093] [ENSMUST00000207904] [ENSMUST00000207987]
Predicted Effect probably damaging
Transcript: ENSMUST00000072219
AA Change: V80A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072076
Gene: ENSMUSG00000095484
AA Change: V80A

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 8.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.6e-6 PFAM
Pfam:7tm_1 40 289 4.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207093
AA Change: V80A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207904
AA Change: V80A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207987
AA Change: V124A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216709
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,964,798 I4F probably benign Het
9430007A20Rik T C 4: 144,519,941 V19A probably benign Het
Abca8a A T 11: 110,053,102 S1114T probably damaging Het
Adgre1 A T 17: 57,401,974 Y55F possibly damaging Het
Alb A C 5: 90,464,051 D113A possibly damaging Het
Ankrd33b C T 15: 31,305,009 R203Q probably damaging Het
Aqp6 T C 15: 99,602,662 V156A possibly damaging Het
AU018091 T C 7: 3,156,344 S616G probably damaging Het
Cfd T A 10: 79,891,607 D68E probably benign Het
Cntn2 C T 1: 132,519,198 A725T probably damaging Het
Copg2 A C 6: 30,824,377 D373E probably damaging Het
Cyp2d11 T C 15: 82,390,432 T315A probably benign Het
Cyp2j13 G T 4: 96,062,067 N232K probably damaging Het
Cyp2j8 A T 4: 96,499,595 F210I probably damaging Het
Dnah9 G A 11: 65,915,154 T3373M probably benign Het
Eif2ak3 A G 6: 70,887,806 K549E probably damaging Het
Epha3 C T 16: 63,583,507 V744I probably damaging Het
Erich6 T C 3: 58,616,447 S669G probably benign Het
Fam90a1a A T 8: 21,961,448 K108N probably damaging Het
Fat1 G A 8: 45,024,792 V2292M probably damaging Het
Fibp T C 19: 5,463,794 C255R probably null Het
Fzd1 A G 5: 4,755,791 V597A possibly damaging Het
Gm12790 G A 4: 101,967,977 A80V possibly damaging Het
Gm2381 A T 7: 42,820,225 N158K probably benign Het
Gm6768 A G 12: 119,262,233 noncoding transcript Het
Impg2 T A 16: 56,265,078 D940E probably benign Het
Ints1 A T 5: 139,762,839 V1071E probably damaging Het
Kat5 A T 19: 5,609,479 Y44* probably null Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra6 A C 6: 130,022,714 L97* probably null Het
Ly6c2 C T 15: 75,111,620 probably null Het
Mettl7a3 A G 15: 100,335,269 N114D probably damaging Het
Mon1a G A 9: 107,898,718 E12K probably benign Het
Myo3b A T 2: 70,245,385 K578* probably null Het
Myrip A T 9: 120,464,774 R778S possibly damaging Het
Olfr1260 A G 2: 89,978,038 R87G probably benign Het
Olfr1362 C T 13: 21,611,070 A300T probably damaging Het
Olfr399 G A 11: 74,053,988 T257I probably damaging Het
Olfr503 T A 7: 108,544,574 F14L probably benign Het
Panx3 T C 9: 37,661,391 I288V probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Pigc T A 1: 161,970,724 S92T probably benign Het
Pou3f2 C A 4: 22,487,255 V293L possibly damaging Het
Rbm15 A G 3: 107,331,220 S621P probably damaging Het
Rnf220 T C 4: 117,489,886 S110G probably benign Het
Rnf38 A T 4: 44,143,593 V115D probably damaging Het
Rps6ka2 A G 17: 7,277,530 H347R probably damaging Het
Ryr2 T C 13: 11,587,442 probably null Het
Sema4f G T 6: 82,917,994 P407T probably damaging Het
Setbp1 T C 18: 78,858,467 T662A probably damaging Het
Slc27a1 C A 8: 71,584,630 probably null Het
Slc41a2 T A 10: 83,233,732 I519F probably damaging Het
Sntg2 C T 12: 30,373,180 S17N possibly damaging Het
Sptb A G 12: 76,612,574 L1184P probably damaging Het
Taf5l G A 8: 124,009,770 Q21* probably null Het
Tbc1d32 A C 10: 56,151,769 S746A possibly damaging Het
Tdrd1 T G 19: 56,842,289 S251R probably benign Het
Thap7 C T 16: 17,528,950 R121Q probably benign Het
Tmem50a A G 4: 134,898,468 V146A probably benign Het
Tmprss15 T C 16: 79,054,070 I327V possibly damaging Het
Ttc23 T C 7: 67,667,176 I65T probably damaging Het
Vmn1r22 G T 6: 57,900,496 H165Q possibly damaging Het
Vopp1 C T 6: 57,762,512 R17H probably damaging Het
Vwa5a A G 9: 38,727,832 K337E probably benign Het
Wrap53 G A 11: 69,563,935 R203* probably null Het
Zfp944 T C 17: 22,339,045 Y407C probably damaging Het
Other mutations in Olfr1480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1480 APN 19 13529850 missense probably damaging 1.00
IGL01446:Olfr1480 APN 19 13530252 missense probably benign 0.00
IGL02300:Olfr1480 APN 19 13529880 missense probably damaging 1.00
IGL02689:Olfr1480 APN 19 13529807 missense probably benign 0.34
IGL03119:Olfr1480 APN 19 13530435 missense probably benign 0.11
R0636:Olfr1480 UTSW 19 13530249 missense possibly damaging 0.89
R1665:Olfr1480 UTSW 19 13529838 missense probably damaging 1.00
R2100:Olfr1480 UTSW 19 13530434 missense probably benign 0.02
R2137:Olfr1480 UTSW 19 13530438 missense probably damaging 0.98
R3879:Olfr1480 UTSW 19 13530249 missense probably damaging 1.00
R3949:Olfr1480 UTSW 19 13530020 missense probably damaging 0.99
R4780:Olfr1480 UTSW 19 13529955 missense probably benign 0.30
R4953:Olfr1480 UTSW 19 13529814 missense probably null 1.00
R5075:Olfr1480 UTSW 19 13530273 missense probably benign 0.17
R5133:Olfr1480 UTSW 19 13530078 missense probably damaging 1.00
R5656:Olfr1480 UTSW 19 13530380 missense probably benign
R6853:Olfr1480 UTSW 19 13529931 missense possibly damaging 0.48
R6890:Olfr1480 UTSW 19 13530081 missense probably damaging 1.00
R7481:Olfr1480 UTSW 19 13530453 missense probably damaging 1.00
R7663:Olfr1480 UTSW 19 13530445 missense probably damaging 0.96
R8869:Olfr1480 UTSW 19 13530528 missense probably damaging 1.00
Z1088:Olfr1480 UTSW 19 13529852 missense possibly damaging 0.64
Z1177:Olfr1480 UTSW 19 13530215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTAGAAAGGAAGCTGTCACACG -3'
(R):5'- AGGGTTTGCACACTGCTGCATAAC -3'

Sequencing Primer
(F):5'- TTGGGTTAACAGATGCACCAC -3'
(R):5'- CTGCTGCATAACGGTCATAGG -3'
Posted On2014-05-14