Mutagenetix > Incidental Mutation

Incidental Mutation 'R1709:Gpd2'

190282

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

MMRRC Submission

039742-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.641) question?

Stock #

R1709 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57237635-57370719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 57357655 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 537 (V537M)

Ref Sequence

ENSEMBL: ENSMUSP00000130992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably damaging
Transcript: ENSMUST00000028167
AA Change: V537M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: V537M

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112618
AA Change: V537M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: V537M

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

probably damaging
Transcript: ENSMUST00000169687
AA Change: V537M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: V537M

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	C	T	5: 9,440,726	R579*	probably null	Het
Aacs	A	G	5: 125,489,878	K152E	probably benign	Het
Adgrd1	T	C	5: 129,179,228	V641A	possibly damaging	Het
Adgrv1	A	T	13: 81,593,060	V95E	probably damaging	Het
Agbl5	G	A	5: 30,906,241	C872Y	probably damaging	Het
Aldh1a7	G	T	19: 20,715,952	T201K	probably damaging	Het
Aox1	C	T	1: 58,077,474	A788V	probably benign	Het
Apob	T	C	12: 8,009,306	V2563A	probably damaging	Het
Atcay	G	A	10: 81,213,231	T179I	probably damaging	Het
Atf5	A	T	7: 44,813,283	L139Q	probably benign	Het
Atp13a3	T	C	16: 30,315,841	T1205A	probably benign	Het
Atr	C	T	9: 95,871,076	T656I	probably benign	Het
Bloc1s3	T	C	7: 19,507,528	E25G	possibly damaging	Het
Brap	T	C	5: 121,665,290		probably null	Het
C6	G	T	15: 4,790,970	A488S	probably benign	Het
Ccin	T	C	4: 43,984,133	F180S	probably damaging	Het
Cd207	T	C	6: 83,672,836	I256V	possibly damaging	Het
Cdc42bpa	G	T	1: 180,067,224	C323F	probably damaging	Het
Cfap57	T	C	4: 118,571,704	T1022A	probably benign	Het
Cmtr2	A	T	8: 110,221,949	Q297L	probably benign	Het
Coro7	A	T	16: 4,634,441		probably null	Het
Cpsf2	T	A	12: 101,999,542	Y589N	probably damaging	Het
Cpxm2	T	C	7: 132,059,834	Y408C	probably damaging	Het
Crocc	A	G	4: 141,026,099		probably null	Het
Cryzl1	A	C	16: 91,712,236	F59C	probably damaging	Het
Csmd2	T	C	4: 128,496,195	V2241A	probably damaging	Het
Cxcl15	C	A	5: 90,801,416	H147N	unknown	Het
Dennd4a	A	G	9: 64,889,605	T860A	possibly damaging	Het
Dnah10	C	T	5: 124,760,091	P966L	probably damaging	Het
Dpp9	T	A	17: 56,194,431	M594L	probably benign	Het
Dspp	C	A	5: 104,175,724	N244K	probably damaging	Het
Efcab8	T	A	2: 153,814,370		probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fbxw17	A	G	13: 50,431,657	M299V	probably benign	Het
Fbxw7	T	A	3: 84,976,352	I530N	probably damaging	Het
Gm13023	T	C	4: 143,793,546	V120A	possibly damaging	Het
Gp2	C	A	7: 119,451,585	D308Y	probably null	Het
Gpr18	T	A	14: 121,911,992	Y207F	probably damaging	Het
Grip1	A	T	10: 119,897,715	D20V	probably damaging	Het
Gzmf	A	C	14: 56,206,940	F59V	probably damaging	Het
Hist1h3a	T	A	13: 23,761,981	I125F	probably damaging	Het
Igfn1	T	C	1: 135,955,573	I2732V	probably benign	Het
Ipo8	A	T	6: 148,782,728	D855E	probably benign	Het
Klrk1	A	T	6: 129,614,719		probably null	Het
Megf11	A	G	9: 64,695,412	Y876C	probably damaging	Het
Mettl8	G	T	2: 70,982,151	Q12K	probably benign	Het
Mrgprf	T	C	7: 145,308,217	F172S	probably benign	Het
Mycbp2	G	A	14: 103,224,416	T1432I	probably damaging	Het
Nek11	A	C	9: 105,348,061	L84R	probably damaging	Het
Nlrp1b	T	C	11: 71,201,273	E9G	probably benign	Het
Nrxn1	T	C	17: 90,037,187	I433V	probably damaging	Het
Nup153	A	G	13: 46,693,974	C660R	probably damaging	Het
Olfr108	T	A	17: 37,446,200	Y226*	probably null	Het
Olfr1427	G	T	19: 12,098,881	P253T	probably damaging	Het
Olfr196	T	A	16: 59,167,901	M81L	probably benign	Het
Olfr447	T	C	6: 42,912,144	V207A	possibly damaging	Het
P2rx7	T	A	5: 122,670,465	N303K	possibly damaging	Het
Pank4	T	C	4: 154,970,047	L159P	probably damaging	Het
Pcdhb22	A	T	18: 37,518,500	H7L	probably benign	Het
Pdzd8	A	T	19: 59,301,339	I543N	probably benign	Het
Prrc2b	C	A	2: 32,194,461	R313S	probably damaging	Het
Rbm12b1	T	C	4: 12,145,827	C600R	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rfx6	T	A	10: 51,678,402	M113K	possibly damaging	Het
Rlf	A	T	4: 121,149,823	D653E	probably benign	Het
Rnf130	A	G	11: 50,087,386	D258G	possibly damaging	Het
Robo2	A	G	16: 73,956,523	V822A	possibly damaging	Het
Rps6kc1	G	T	1: 190,800,336	Q490K	possibly damaging	Het
Scn9a	T	C	2: 66,483,506	Y1945C	probably damaging	Het
Setd2	T	A	9: 110,549,857	D913E	probably benign	Het
Sfr1	G	T	19: 47,735,003	E315D	possibly damaging	Het
Smarca5	G	A	8: 80,709,220	R763*	probably null	Het
Sugct	A	C	13: 17,672,566	I44S	probably damaging	Het
Syce1l	A	G	8: 113,654,030		probably null	Het
Tbc1d8b	A	G	X: 139,734,080	I654V	probably benign	Het
Tcf23	T	A	5: 30,973,508	Y163*	probably null	Het
Terf2ip	TG	T	8: 112,011,606		probably null	Het
Tmem158	T	C	9: 123,259,885	S221G	possibly damaging	Het
Tnrc6a	A	G	7: 123,169,982	T332A	probably benign	Het
Trappc4	T	C	9: 44,407,211	T31A	probably benign	Het
Trim27	T	C	13: 21,188,065		probably null	Het
Ttyh2	T	A	11: 114,708,475	L330Q	probably damaging	Het
Tubgcp3	A	T	8: 12,639,532	L578*	probably null	Het
Txndc11	C	A	16: 11,128,701	E83*	probably null	Het
Utp20	T	C	10: 88,749,297	K2635R	probably benign	Het
V1ra8	C	T	6: 90,203,322	T169I	probably damaging	Het
Vcl	G	A	14: 21,019,373	V706I	probably benign	Het
Vmn2r106	A	T	17: 20,279,111	D179E	probably benign	Het
Vmn2r80	T	C	10: 79,194,389	M683T	probably benign	Het
Xirp2	A	G	2: 67,509,871	I819V	probably benign	Het
Zfp735	T	C	11: 73,711,763	F511S	probably benign	Het
Zfp831	T	C	2: 174,645,890	V786A	probably benign	Het
Zfp992	T	A	4: 146,466,492	H223Q	probably benign	Het
Zfyve19	A	C	2: 119,210,819	Q72P	probably damaging	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57268084	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57364530	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57338867	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57268071	nonsense	probably null
IGL01816:Gpd2	APN	2	57364066	nonsense	probably null
IGL02257:Gpd2	APN	2	57364524	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57364327	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57338979	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57355793	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57355569	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57338843	splice site	probably benign
IGL03218:Gpd2	APN	2	57307054	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57304486	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57355507	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57338868	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57338955	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57345263	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57340093	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57355475	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57357700	missense	probably damaging	0.97
R1735:Gpd2	UTSW	2	57355551	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57339013	critical splice donor site	probably null
R2959:Gpd2	UTSW	2	57338975	nonsense	probably null
R2960:Gpd2	UTSW	2	57338975	nonsense	probably null
R2961:Gpd2	UTSW	2	57338975	nonsense	probably null
R2962:Gpd2	UTSW	2	57338975	nonsense	probably null
R3008:Gpd2	UTSW	2	57338975	nonsense	probably null
R3009:Gpd2	UTSW	2	57338975	nonsense	probably null
R3881:Gpd2	UTSW	2	57338975	nonsense	probably null
R4073:Gpd2	UTSW	2	57290013	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57355771	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57307083	missense	possibly damaging	0.77
R4952:Gpd2	UTSW	2	57307013	nonsense	probably null
R5030:Gpd2	UTSW	2	57304405	missense	probably damaging	0.98
R5101:Gpd2	UTSW	2	57355901	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57340204	missense	probably damaging	1.00
R6020:Gpd2	UTSW	2	57364513	missense	probably benign	0.18
R6325:Gpd2	UTSW	2	57304396	missense	probably damaging	0.96
R6536:Gpd2	UTSW	2	57345355	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57355788	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57307100	splice site	probably null
R7380:Gpd2	UTSW	2	57340159	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57306950	nonsense	probably null
R8098:Gpd2	UTSW	2	57290008	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57364584	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57307050	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57305854	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GTTAGCAAGGAGAGCGATTCCTGTG -3'
(R):5'- ACCTAGAAAAGGCTGCATCCAACTG -3'

Sequencing Primer
(F):5'- TTCAGGAAAAAGGCATTCACTC -3'
(R):5'- GACCAAGCTGTTACATGGTTACC -3'

Posted On

2014-05-14