Incidental Mutation 'R1709:Fbxw7'
ID190291
Institutional Source Beutler Lab
Gene Symbol Fbxw7
Ensembl Gene ENSMUSG00000028086
Gene NameF-box and WD-40 domain protein 7
SynonymsFbw7, 1110001A17Rik, AGO, Cdc4, Fbxw6, SEL-10, Fbxo30
MMRRC Submission 039742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1709 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84815268-84979198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84976352 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 530 (I530N)
Ref Sequence ENSEMBL: ENSMUSP00000029727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029727] [ENSMUST00000107675] [ENSMUST00000107678] [ENSMUST00000107679] [ENSMUST00000154148]
Predicted Effect probably damaging
Transcript: ENSMUST00000029727
AA Change: I530N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029727
Gene: ENSMUSG00000028086
AA Change: I530N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 139 146 N/A INTRINSIC
FBOX 206 246 3.7e-8 SMART
WD40 291 329 3.14e-6 SMART
WD40 332 369 2.1e-7 SMART
WD40 372 409 7.55e-9 SMART
WD40 412 449 2.22e-6 SMART
WD40 452 489 1.07e-8 SMART
WD40 492 529 1.75e-4 SMART
WD40 532 572 2.32e-9 SMART
WD40 575 623 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107675
AA Change: I490N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103302
Gene: ENSMUSG00000028086
AA Change: I490N

DomainStartEndE-ValueType
low complexity region 99 106 N/A INTRINSIC
FBOX 166 206 3.7e-8 SMART
WD40 251 289 3.14e-6 SMART
WD40 292 329 2.1e-7 SMART
WD40 332 369 7.55e-9 SMART
WD40 372 409 2.22e-6 SMART
WD40 412 449 1.07e-8 SMART
WD40 452 489 1.75e-4 SMART
WD40 492 532 2.32e-9 SMART
WD40 535 583 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107678
AA Change: I611N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103305
Gene: ENSMUSG00000028086
AA Change: I611N

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107679
AA Change: I611N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103306
Gene: ENSMUSG00000028086
AA Change: I611N

DomainStartEndE-ValueType
coiled coil region 94 129 N/A INTRINSIC
low complexity region 220 227 N/A INTRINSIC
FBOX 287 327 3.7e-8 SMART
WD40 372 410 3.14e-6 SMART
WD40 413 450 2.1e-7 SMART
WD40 453 490 7.55e-9 SMART
WD40 493 530 2.22e-6 SMART
WD40 533 570 1.07e-8 SMART
WD40 573 610 1.75e-4 SMART
WD40 613 653 2.32e-9 SMART
WD40 656 704 2.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151410
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene was previously referred to as FBX30, and belongs to the Fbws class; in addition to an F-box, this protein contains 7 tandem WD40 repeats. This protein binds directly to cyclin E and probably targets cyclin E for ubiquitin-mediated degradation. Mutations in this gene are detected in ovarian and breast cancer cell lines, implicating the gene's potential role in the pathogenesis of human cancers. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this locus disrupts embryonic and extraembryonic vasculature, resulting in death by midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik C T 5: 9,440,726 R579* probably null Het
Aacs A G 5: 125,489,878 K152E probably benign Het
Adgrd1 T C 5: 129,179,228 V641A possibly damaging Het
Adgrv1 A T 13: 81,593,060 V95E probably damaging Het
Agbl5 G A 5: 30,906,241 C872Y probably damaging Het
Aldh1a7 G T 19: 20,715,952 T201K probably damaging Het
Aox1 C T 1: 58,077,474 A788V probably benign Het
Apob T C 12: 8,009,306 V2563A probably damaging Het
Atcay G A 10: 81,213,231 T179I probably damaging Het
Atf5 A T 7: 44,813,283 L139Q probably benign Het
Atp13a3 T C 16: 30,315,841 T1205A probably benign Het
Atr C T 9: 95,871,076 T656I probably benign Het
Bloc1s3 T C 7: 19,507,528 E25G possibly damaging Het
Brap T C 5: 121,665,290 probably null Het
C6 G T 15: 4,790,970 A488S probably benign Het
Ccin T C 4: 43,984,133 F180S probably damaging Het
Cd207 T C 6: 83,672,836 I256V possibly damaging Het
Cdc42bpa G T 1: 180,067,224 C323F probably damaging Het
Cfap57 T C 4: 118,571,704 T1022A probably benign Het
Cmtr2 A T 8: 110,221,949 Q297L probably benign Het
Coro7 A T 16: 4,634,441 probably null Het
Cpsf2 T A 12: 101,999,542 Y589N probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Crocc A G 4: 141,026,099 probably null Het
Cryzl1 A C 16: 91,712,236 F59C probably damaging Het
Csmd2 T C 4: 128,496,195 V2241A probably damaging Het
Cxcl15 C A 5: 90,801,416 H147N unknown Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dnah10 C T 5: 124,760,091 P966L probably damaging Het
Dpp9 T A 17: 56,194,431 M594L probably benign Het
Dspp C A 5: 104,175,724 N244K probably damaging Het
Efcab8 T A 2: 153,814,370 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw17 A G 13: 50,431,657 M299V probably benign Het
Gm13023 T C 4: 143,793,546 V120A possibly damaging Het
Gp2 C A 7: 119,451,585 D308Y probably null Het
Gpd2 G A 2: 57,357,655 V537M probably damaging Het
Gpr18 T A 14: 121,911,992 Y207F probably damaging Het
Grip1 A T 10: 119,897,715 D20V probably damaging Het
Gzmf A C 14: 56,206,940 F59V probably damaging Het
Hist1h3a T A 13: 23,761,981 I125F probably damaging Het
Igfn1 T C 1: 135,955,573 I2732V probably benign Het
Ipo8 A T 6: 148,782,728 D855E probably benign Het
Klrk1 A T 6: 129,614,719 probably null Het
Megf11 A G 9: 64,695,412 Y876C probably damaging Het
Mettl8 G T 2: 70,982,151 Q12K probably benign Het
Mrgprf T C 7: 145,308,217 F172S probably benign Het
Mycbp2 G A 14: 103,224,416 T1432I probably damaging Het
Nek11 A C 9: 105,348,061 L84R probably damaging Het
Nlrp1b T C 11: 71,201,273 E9G probably benign Het
Nrxn1 T C 17: 90,037,187 I433V probably damaging Het
Nup153 A G 13: 46,693,974 C660R probably damaging Het
Olfr108 T A 17: 37,446,200 Y226* probably null Het
Olfr1427 G T 19: 12,098,881 P253T probably damaging Het
Olfr196 T A 16: 59,167,901 M81L probably benign Het
Olfr447 T C 6: 42,912,144 V207A possibly damaging Het
P2rx7 T A 5: 122,670,465 N303K possibly damaging Het
Pank4 T C 4: 154,970,047 L159P probably damaging Het
Pcdhb22 A T 18: 37,518,500 H7L probably benign Het
Pdzd8 A T 19: 59,301,339 I543N probably benign Het
Prrc2b C A 2: 32,194,461 R313S probably damaging Het
Rbm12b1 T C 4: 12,145,827 C600R probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rfx6 T A 10: 51,678,402 M113K possibly damaging Het
Rlf A T 4: 121,149,823 D653E probably benign Het
Rnf130 A G 11: 50,087,386 D258G possibly damaging Het
Robo2 A G 16: 73,956,523 V822A possibly damaging Het
Rps6kc1 G T 1: 190,800,336 Q490K possibly damaging Het
Scn9a T C 2: 66,483,506 Y1945C probably damaging Het
Setd2 T A 9: 110,549,857 D913E probably benign Het
Sfr1 G T 19: 47,735,003 E315D possibly damaging Het
Smarca5 G A 8: 80,709,220 R763* probably null Het
Sugct A C 13: 17,672,566 I44S probably damaging Het
Syce1l A G 8: 113,654,030 probably null Het
Tbc1d8b A G X: 139,734,080 I654V probably benign Het
Tcf23 T A 5: 30,973,508 Y163* probably null Het
Terf2ip TG T 8: 112,011,606 probably null Het
Tmem158 T C 9: 123,259,885 S221G possibly damaging Het
Tnrc6a A G 7: 123,169,982 T332A probably benign Het
Trappc4 T C 9: 44,407,211 T31A probably benign Het
Trim27 T C 13: 21,188,065 probably null Het
Ttyh2 T A 11: 114,708,475 L330Q probably damaging Het
Tubgcp3 A T 8: 12,639,532 L578* probably null Het
Txndc11 C A 16: 11,128,701 E83* probably null Het
Utp20 T C 10: 88,749,297 K2635R probably benign Het
V1ra8 C T 6: 90,203,322 T169I probably damaging Het
Vcl G A 14: 21,019,373 V706I probably benign Het
Vmn2r106 A T 17: 20,279,111 D179E probably benign Het
Vmn2r80 T C 10: 79,194,389 M683T probably benign Het
Xirp2 A G 2: 67,509,871 I819V probably benign Het
Zfp735 T C 11: 73,711,763 F511S probably benign Het
Zfp831 T C 2: 174,645,890 V786A probably benign Het
Zfp992 T A 4: 146,466,492 H223Q probably benign Het
Zfyve19 A C 2: 119,210,819 Q72P probably damaging Het
Other mutations in Fbxw7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Fbxw7 APN 3 84969309 intron probably benign
IGL01468:Fbxw7 APN 3 84972499 missense probably benign 0.21
IGL01946:Fbxw7 APN 3 84904062 missense possibly damaging 0.60
IGL02248:Fbxw7 APN 3 84903633 missense possibly damaging 0.94
IGL02630:Fbxw7 APN 3 84965279 missense probably damaging 1.00
IGL02957:Fbxw7 APN 3 84976237 missense probably benign 0.00
PIT4453001:Fbxw7 UTSW 3 84965314 missense
R0043:Fbxw7 UTSW 3 84972567 intron probably benign
R0312:Fbxw7 UTSW 3 84967569 intron probably benign
R0595:Fbxw7 UTSW 3 84977367 intron probably null
R1664:Fbxw7 UTSW 3 84969171 missense possibly damaging 0.45
R1782:Fbxw7 UTSW 3 84903819 missense probably benign
R1974:Fbxw7 UTSW 3 84954935 missense possibly damaging 0.53
R2081:Fbxw7 UTSW 3 84974513 missense probably damaging 1.00
R2843:Fbxw7 UTSW 3 84976220 missense probably damaging 1.00
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3732:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R3733:Fbxw7 UTSW 3 84925707 missense possibly damaging 0.72
R4333:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4335:Fbxw7 UTSW 3 84972495 missense probably damaging 1.00
R4581:Fbxw7 UTSW 3 84967545 missense probably benign 0.41
R4776:Fbxw7 UTSW 3 84925689 missense possibly damaging 0.53
R4799:Fbxw7 UTSW 3 84903861 nonsense probably null
R4822:Fbxw7 UTSW 3 84967507 missense possibly damaging 0.94
R5512:Fbxw7 UTSW 3 84954909 missense probably damaging 0.99
R5601:Fbxw7 UTSW 3 84976208 missense probably damaging 1.00
R5679:Fbxw7 UTSW 3 84977487 missense probably damaging 1.00
R6026:Fbxw7 UTSW 3 84952641 critical splice donor site probably null
R6182:Fbxw7 UTSW 3 84815771 critical splice donor site probably null
R6219:Fbxw7 UTSW 3 84969213 missense probably damaging 0.99
R6305:Fbxw7 UTSW 3 84976323 missense probably damaging 1.00
R6473:Fbxw7 UTSW 3 84952380 intron probably benign
R6823:Fbxw7 UTSW 3 84958627 missense probably benign 0.33
R6922:Fbxw7 UTSW 3 84972416 intron probably null
R7163:Fbxw7 UTSW 3 84925585 intron probably benign
R7229:Fbxw7 UTSW 3 84977369 missense unknown
R7554:Fbxw7 UTSW 3 84976313 missense
R7677:Fbxw7 UTSW 3 84904066 missense
R7711:Fbxw7 UTSW 3 84925681 missense probably benign
R7713:Fbxw7 UTSW 3 84967565 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGCAAGTTTATCCCAGTAGGCTC -3'
(R):5'- GACCAAGCAAGGCCAAAGTCATTTC -3'

Sequencing Primer
(F):5'- CCCTATTGTGAGTAATGTCAACAGC -3'
(R):5'- GGCCAAAGTCATTTCCTATCAGAG -3'
Posted On2014-05-14