Incidental Mutation 'R1709:Cfap57'
ID 190295
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 039742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1709 (G1)
Quality Score 127
Status Not validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118571704 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1022 (T1022A)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: T1022A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: T1022A

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: T1022A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: T1022A

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik C T 5: 9,440,726 R579* probably null Het
Aacs A G 5: 125,489,878 K152E probably benign Het
Adgrd1 T C 5: 129,179,228 V641A possibly damaging Het
Adgrv1 A T 13: 81,593,060 V95E probably damaging Het
Agbl5 G A 5: 30,906,241 C872Y probably damaging Het
Aldh1a7 G T 19: 20,715,952 T201K probably damaging Het
Aox1 C T 1: 58,077,474 A788V probably benign Het
Apob T C 12: 8,009,306 V2563A probably damaging Het
Atcay G A 10: 81,213,231 T179I probably damaging Het
Atf5 A T 7: 44,813,283 L139Q probably benign Het
Atp13a3 T C 16: 30,315,841 T1205A probably benign Het
Atr C T 9: 95,871,076 T656I probably benign Het
Bloc1s3 T C 7: 19,507,528 E25G possibly damaging Het
Brap T C 5: 121,665,290 probably null Het
C6 G T 15: 4,790,970 A488S probably benign Het
Ccin T C 4: 43,984,133 F180S probably damaging Het
Cd207 T C 6: 83,672,836 I256V possibly damaging Het
Cdc42bpa G T 1: 180,067,224 C323F probably damaging Het
Cmtr2 A T 8: 110,221,949 Q297L probably benign Het
Coro7 A T 16: 4,634,441 probably null Het
Cpsf2 T A 12: 101,999,542 Y589N probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Crocc A G 4: 141,026,099 probably null Het
Cryzl1 A C 16: 91,712,236 F59C probably damaging Het
Csmd2 T C 4: 128,496,195 V2241A probably damaging Het
Cxcl15 C A 5: 90,801,416 H147N unknown Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dnah10 C T 5: 124,760,091 P966L probably damaging Het
Dpp9 T A 17: 56,194,431 M594L probably benign Het
Dspp C A 5: 104,175,724 N244K probably damaging Het
Efcab8 T A 2: 153,814,370 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw17 A G 13: 50,431,657 M299V probably benign Het
Fbxw7 T A 3: 84,976,352 I530N probably damaging Het
Gm13023 T C 4: 143,793,546 V120A possibly damaging Het
Gp2 C A 7: 119,451,585 D308Y probably null Het
Gpd2 G A 2: 57,357,655 V537M probably damaging Het
Gpr18 T A 14: 121,911,992 Y207F probably damaging Het
Grip1 A T 10: 119,897,715 D20V probably damaging Het
Gzmf A C 14: 56,206,940 F59V probably damaging Het
Hist1h3a T A 13: 23,761,981 I125F probably damaging Het
Igfn1 T C 1: 135,955,573 I2732V probably benign Het
Ipo8 A T 6: 148,782,728 D855E probably benign Het
Klrk1 A T 6: 129,614,719 probably null Het
Megf11 A G 9: 64,695,412 Y876C probably damaging Het
Mettl8 G T 2: 70,982,151 Q12K probably benign Het
Mrgprf T C 7: 145,308,217 F172S probably benign Het
Mycbp2 G A 14: 103,224,416 T1432I probably damaging Het
Nek11 A C 9: 105,348,061 L84R probably damaging Het
Nlrp1b T C 11: 71,201,273 E9G probably benign Het
Nrxn1 T C 17: 90,037,187 I433V probably damaging Het
Nup153 A G 13: 46,693,974 C660R probably damaging Het
Olfr108 T A 17: 37,446,200 Y226* probably null Het
Olfr1427 G T 19: 12,098,881 P253T probably damaging Het
Olfr196 T A 16: 59,167,901 M81L probably benign Het
Olfr447 T C 6: 42,912,144 V207A possibly damaging Het
P2rx7 T A 5: 122,670,465 N303K possibly damaging Het
Pank4 T C 4: 154,970,047 L159P probably damaging Het
Pcdhb22 A T 18: 37,518,500 H7L probably benign Het
Pdzd8 A T 19: 59,301,339 I543N probably benign Het
Prrc2b C A 2: 32,194,461 R313S probably damaging Het
Rbm12b1 T C 4: 12,145,827 C600R probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rfx6 T A 10: 51,678,402 M113K possibly damaging Het
Rlf A T 4: 121,149,823 D653E probably benign Het
Rnf130 A G 11: 50,087,386 D258G possibly damaging Het
Robo2 A G 16: 73,956,523 V822A possibly damaging Het
Rps6kc1 G T 1: 190,800,336 Q490K possibly damaging Het
Scn9a T C 2: 66,483,506 Y1945C probably damaging Het
Setd2 T A 9: 110,549,857 D913E probably benign Het
Sfr1 G T 19: 47,735,003 E315D possibly damaging Het
Smarca5 G A 8: 80,709,220 R763* probably null Het
Sugct A C 13: 17,672,566 I44S probably damaging Het
Syce1l A G 8: 113,654,030 probably null Het
Tbc1d8b A G X: 139,734,080 I654V probably benign Het
Tcf23 T A 5: 30,973,508 Y163* probably null Het
Terf2ip TG T 8: 112,011,606 probably null Het
Tmem158 T C 9: 123,259,885 S221G possibly damaging Het
Tnrc6a A G 7: 123,169,982 T332A probably benign Het
Trappc4 T C 9: 44,407,211 T31A probably benign Het
Trim27 T C 13: 21,188,065 probably null Het
Ttyh2 T A 11: 114,708,475 L330Q probably damaging Het
Tubgcp3 A T 8: 12,639,532 L578* probably null Het
Txndc11 C A 16: 11,128,701 E83* probably null Het
Utp20 T C 10: 88,749,297 K2635R probably benign Het
V1ra8 C T 6: 90,203,322 T169I probably damaging Het
Vcl G A 14: 21,019,373 V706I probably benign Het
Vmn2r106 A T 17: 20,279,111 D179E probably benign Het
Vmn2r80 T C 10: 79,194,389 M683T probably benign Het
Xirp2 A G 2: 67,509,871 I819V probably benign Het
Zfp735 T C 11: 73,711,763 F511S probably benign Het
Zfp831 T C 2: 174,645,890 V786A probably benign Het
Zfp992 T A 4: 146,466,492 H223Q probably benign Het
Zfyve19 A C 2: 119,210,819 Q72P probably damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense probably benign
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense probably benign
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense probably benign
R7412:Cfap57 UTSW 4 118614931 missense probably benign
R7414:Cfap57 UTSW 4 118614931 missense probably benign
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense probably benign
R7642:Cfap57 UTSW 4 118614931 missense probably benign
R7741:Cfap57 UTSW 4 118614931 missense probably benign
R7744:Cfap57 UTSW 4 118614931 missense probably benign
R7745:Cfap57 UTSW 4 118614931 missense probably benign
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7936:Cfap57 UTSW 4 118614931 missense probably benign
R7940:Cfap57 UTSW 4 118614931 missense probably benign
R7942:Cfap57 UTSW 4 118614931 missense probably benign
R8074:Cfap57 UTSW 4 118569625 missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118614931 missense probably benign
R8447:Cfap57 UTSW 4 118614931 missense probably benign
R8491:Cfap57 UTSW 4 118614931 missense probably benign
R8524:Cfap57 UTSW 4 118614931 missense probably benign
R8670:Cfap57 UTSW 4 118614925 missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118593006 missense probably benign 0.04
R8790:Cfap57 UTSW 4 118581914 missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118569602 missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118554851 missense probably benign 0.02
R9212:Cfap57 UTSW 4 118579452 missense possibly damaging 0.95
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCAGGTCAAACAGAGCCAAGG -3'
(R):5'- CAAGTGTCAAGGAGCAAGGTCTCAC -3'

Sequencing Primer
(F):5'- ccctctcctccctccctc -3'
(R):5'- GGTCTCACTCCCAACACATCG -3'
Posted On 2014-05-14