Incidental Mutation 'R1709:Brap'
List |< first << previous [record 14 of 95] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Brap
Ensembl Gene ENSMUSG00000029458
Gene NameBRCA1 associated protein
MMRRC Submission 039742-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1709 (G1)
Quality Score225
Status Not validated
Chromosomal Location121660563-121687256 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 121665290 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000031414] [ENSMUST00000111765] [ENSMUST00000111765] [ENSMUST00000111770] [ENSMUST00000140996] [ENSMUST00000142701] [ENSMUST00000195952]
Predicted Effect probably benign
Transcript: ENSMUST00000031412
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456

Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031414
SMART Domains Protein: ENSMUSP00000031414
Gene: ENSMUSG00000029458

Pfam:BRAP2 153 251 3.7e-38 PFAM
RING 263 302 7.92e-8 SMART
ZnF_UBP 315 364 1.68e-25 SMART
coiled coil region 430 535 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111765
SMART Domains Protein: ENSMUSP00000107395
Gene: ENSMUSG00000029458

Pfam:BRAP2 117 226 3.5e-41 PFAM
RING 233 272 3.7e-10 SMART
ZnF_UBP 285 334 1.1e-27 SMART
coiled coil region 400 505 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111765
SMART Domains Protein: ENSMUSP00000107395
Gene: ENSMUSG00000029458

Pfam:BRAP2 117 226 3.5e-41 PFAM
RING 233 272 3.7e-10 SMART
ZnF_UBP 285 334 1.1e-27 SMART
coiled coil region 400 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111770
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456

Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127703
SMART Domains Protein: ENSMUSP00000118574
Gene: ENSMUSG00000029458

Pfam:BRAP2 1 39 6.3e-13 PFAM
RING 46 85 7.92e-8 SMART
ZnF_UBP 98 147 1.68e-25 SMART
coiled coil region 213 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Predicted Effect probably benign
Transcript: ENSMUST00000140996
Predicted Effect probably benign
Transcript: ENSMUST00000142701
AA Change: V167A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143043
Gene: ENSMUSG00000029458
AA Change: V167A

Pfam:BRAP2 103 175 3.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148052
Predicted Effect probably benign
Transcript: ENSMUST00000195952
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its ability to bind to the nuclear localization signal of BRCA1 and other proteins. It is a cytoplasmic protein which may regulate nuclear targeting by retaining proteins with a nuclear localization signal in the cytoplasm. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis and subtle defects in cell cycle-dependent nuclear movement in neural progenitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik C T 5: 9,440,726 R579* probably null Het
Aacs A G 5: 125,489,878 K152E probably benign Het
Adgrd1 T C 5: 129,179,228 V641A possibly damaging Het
Adgrv1 A T 13: 81,593,060 V95E probably damaging Het
Agbl5 G A 5: 30,906,241 C872Y probably damaging Het
Aldh1a7 G T 19: 20,715,952 T201K probably damaging Het
Aox1 C T 1: 58,077,474 A788V probably benign Het
Apob T C 12: 8,009,306 V2563A probably damaging Het
Atcay G A 10: 81,213,231 T179I probably damaging Het
Atf5 A T 7: 44,813,283 L139Q probably benign Het
Atp13a3 T C 16: 30,315,841 T1205A probably benign Het
Atr C T 9: 95,871,076 T656I probably benign Het
Bloc1s3 T C 7: 19,507,528 E25G possibly damaging Het
C6 G T 15: 4,790,970 A488S probably benign Het
Ccin T C 4: 43,984,133 F180S probably damaging Het
Cd207 T C 6: 83,672,836 I256V possibly damaging Het
Cdc42bpa G T 1: 180,067,224 C323F probably damaging Het
Cfap57 T C 4: 118,571,704 T1022A probably benign Het
Cmtr2 A T 8: 110,221,949 Q297L probably benign Het
Coro7 A T 16: 4,634,441 probably null Het
Cpsf2 T A 12: 101,999,542 Y589N probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Crocc A G 4: 141,026,099 probably null Het
Cryzl1 A C 16: 91,712,236 F59C probably damaging Het
Csmd2 T C 4: 128,496,195 V2241A probably damaging Het
Cxcl15 C A 5: 90,801,416 H147N unknown Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dnah10 C T 5: 124,760,091 P966L probably damaging Het
Dpp9 T A 17: 56,194,431 M594L probably benign Het
Dspp C A 5: 104,175,724 N244K probably damaging Het
Efcab8 T A 2: 153,814,370 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw17 A G 13: 50,431,657 M299V probably benign Het
Fbxw7 T A 3: 84,976,352 I530N probably damaging Het
Gm13023 T C 4: 143,793,546 V120A possibly damaging Het
Gp2 C A 7: 119,451,585 D308Y probably null Het
Gpd2 G A 2: 57,357,655 V537M probably damaging Het
Gpr18 T A 14: 121,911,992 Y207F probably damaging Het
Grip1 A T 10: 119,897,715 D20V probably damaging Het
Gzmf A C 14: 56,206,940 F59V probably damaging Het
Hist1h3a T A 13: 23,761,981 I125F probably damaging Het
Igfn1 T C 1: 135,955,573 I2732V probably benign Het
Ipo8 A T 6: 148,782,728 D855E probably benign Het
Klrk1 A T 6: 129,614,719 probably null Het
Megf11 A G 9: 64,695,412 Y876C probably damaging Het
Mettl8 G T 2: 70,982,151 Q12K probably benign Het
Mrgprf T C 7: 145,308,217 F172S probably benign Het
Mycbp2 G A 14: 103,224,416 T1432I probably damaging Het
Nek11 A C 9: 105,348,061 L84R probably damaging Het
Nlrp1b T C 11: 71,201,273 E9G probably benign Het
Nrxn1 T C 17: 90,037,187 I433V probably damaging Het
Nup153 A G 13: 46,693,974 C660R probably damaging Het
Olfr108 T A 17: 37,446,200 Y226* probably null Het
Olfr1427 G T 19: 12,098,881 P253T probably damaging Het
Olfr196 T A 16: 59,167,901 M81L probably benign Het
Olfr447 T C 6: 42,912,144 V207A possibly damaging Het
P2rx7 T A 5: 122,670,465 N303K possibly damaging Het
Pank4 T C 4: 154,970,047 L159P probably damaging Het
Pcdhb22 A T 18: 37,518,500 H7L probably benign Het
Pdzd8 A T 19: 59,301,339 I543N probably benign Het
Prrc2b C A 2: 32,194,461 R313S probably damaging Het
Rbm12b1 T C 4: 12,145,827 C600R probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rfx6 T A 10: 51,678,402 M113K possibly damaging Het
Rlf A T 4: 121,149,823 D653E probably benign Het
Rnf130 A G 11: 50,087,386 D258G possibly damaging Het
Robo2 A G 16: 73,956,523 V822A possibly damaging Het
Rps6kc1 G T 1: 190,800,336 Q490K possibly damaging Het
Scn9a T C 2: 66,483,506 Y1945C probably damaging Het
Setd2 T A 9: 110,549,857 D913E probably benign Het
Sfr1 G T 19: 47,735,003 E315D possibly damaging Het
Smarca5 G A 8: 80,709,220 R763* probably null Het
Sugct A C 13: 17,672,566 I44S probably damaging Het
Syce1l A G 8: 113,654,030 probably null Het
Tbc1d8b A G X: 139,734,080 I654V probably benign Het
Tcf23 T A 5: 30,973,508 Y163* probably null Het
Terf2ip TG T 8: 112,011,606 probably null Het
Tmem158 T C 9: 123,259,885 S221G possibly damaging Het
Tnrc6a A G 7: 123,169,982 T332A probably benign Het
Trappc4 T C 9: 44,407,211 T31A probably benign Het
Trim27 T C 13: 21,188,065 probably null Het
Ttyh2 T A 11: 114,708,475 L330Q probably damaging Het
Tubgcp3 A T 8: 12,639,532 L578* probably null Het
Txndc11 C A 16: 11,128,701 E83* probably null Het
Utp20 T C 10: 88,749,297 K2635R probably benign Het
V1ra8 C T 6: 90,203,322 T169I probably damaging Het
Vcl G A 14: 21,019,373 V706I probably benign Het
Vmn2r106 A T 17: 20,279,111 D179E probably benign Het
Vmn2r80 T C 10: 79,194,389 M683T probably benign Het
Xirp2 A G 2: 67,509,871 I819V probably benign Het
Zfp735 T C 11: 73,711,763 F511S probably benign Het
Zfp831 T C 2: 174,645,890 V786A probably benign Het
Zfp992 T A 4: 146,466,492 H223Q probably benign Het
Zfyve19 A C 2: 119,210,819 Q72P probably damaging Het
Other mutations in Brap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Brap APN 5 121665227 missense probably damaging 1.00
IGL01672:Brap APN 5 121678845 unclassified probably benign
IGL01889:Brap APN 5 121660818 missense probably benign 0.00
IGL01977:Brap APN 5 121678847 unclassified probably benign
IGL01978:Brap APN 5 121678847 unclassified probably benign
IGL01996:Brap APN 5 121678847 unclassified probably benign
IGL02499:Brap APN 5 121679871 missense probably damaging 0.99
IGL03137:Brap APN 5 121665093 splice site probably benign
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1185:Brap UTSW 5 121675279 missense probably damaging 1.00
R1624:Brap UTSW 5 121682859 missense possibly damaging 0.65
R2056:Brap UTSW 5 121663466 missense probably damaging 1.00
R2109:Brap UTSW 5 121663359 missense possibly damaging 0.63
R3196:Brap UTSW 5 121665196 missense possibly damaging 0.70
R4591:Brap UTSW 5 121662050 missense probably null 1.00
R4744:Brap UTSW 5 121662130 missense probably damaging 1.00
R4924:Brap UTSW 5 121665255 missense probably damaging 1.00
R5000:Brap UTSW 5 121662026 nonsense probably null
R5702:Brap UTSW 5 121665143 missense probably damaging 1.00
R5893:Brap UTSW 5 121679342 nonsense probably null
R6244:Brap UTSW 5 121665309 missense probably benign 0.02
R6266:Brap UTSW 5 121685265 missense probably benign 0.00
R6726:Brap UTSW 5 121675302 missense probably damaging 1.00
R7765:Brap UTSW 5 121662129 missense probably damaging 1.00
X0003:Brap UTSW 5 121679256 missense probably damaging 1.00
Predicted Primers PCR Primer
(R):5'- ccatctcaccagcccGTAATTGTATTTC -3'

Sequencing Primer
(F):5'- tgtgaggtgaatacaagcaaaatac -3'
Posted On2014-05-14