Incidental Mutation 'R1709:Adgrd1'
ID190313
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Nameadhesion G protein-coupled receptor D1
SynonymsE230012M21Rik, Gpr133
MMRRC Submission 039742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1709 (G1)
Quality Score215
Status Not validated
Chromosome5
Chromosomal Location129096750-129204599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129179228 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 641 (V641A)
Ref Sequence ENSEMBL: ENSMUSP00000060307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056617
AA Change: V641A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017
AA Change: V641A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156437
AA Change: V609A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017
AA Change: V609A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik C T 5: 9,440,726 R579* probably null Het
Aacs A G 5: 125,489,878 K152E probably benign Het
Adgrv1 A T 13: 81,593,060 V95E probably damaging Het
Agbl5 G A 5: 30,906,241 C872Y probably damaging Het
Aldh1a7 G T 19: 20,715,952 T201K probably damaging Het
Aox1 C T 1: 58,077,474 A788V probably benign Het
Apob T C 12: 8,009,306 V2563A probably damaging Het
Atcay G A 10: 81,213,231 T179I probably damaging Het
Atf5 A T 7: 44,813,283 L139Q probably benign Het
Atp13a3 T C 16: 30,315,841 T1205A probably benign Het
Atr C T 9: 95,871,076 T656I probably benign Het
Bloc1s3 T C 7: 19,507,528 E25G possibly damaging Het
Brap T C 5: 121,665,290 probably null Het
C6 G T 15: 4,790,970 A488S probably benign Het
Ccin T C 4: 43,984,133 F180S probably damaging Het
Cd207 T C 6: 83,672,836 I256V possibly damaging Het
Cdc42bpa G T 1: 180,067,224 C323F probably damaging Het
Cfap57 T C 4: 118,571,704 T1022A probably benign Het
Cmtr2 A T 8: 110,221,949 Q297L probably benign Het
Coro7 A T 16: 4,634,441 probably null Het
Cpsf2 T A 12: 101,999,542 Y589N probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Crocc A G 4: 141,026,099 probably null Het
Cryzl1 A C 16: 91,712,236 F59C probably damaging Het
Csmd2 T C 4: 128,496,195 V2241A probably damaging Het
Cxcl15 C A 5: 90,801,416 H147N unknown Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dnah10 C T 5: 124,760,091 P966L probably damaging Het
Dpp9 T A 17: 56,194,431 M594L probably benign Het
Dspp C A 5: 104,175,724 N244K probably damaging Het
Efcab8 T A 2: 153,814,370 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw17 A G 13: 50,431,657 M299V probably benign Het
Fbxw7 T A 3: 84,976,352 I530N probably damaging Het
Gm13023 T C 4: 143,793,546 V120A possibly damaging Het
Gp2 C A 7: 119,451,585 D308Y probably null Het
Gpd2 G A 2: 57,357,655 V537M probably damaging Het
Gpr18 T A 14: 121,911,992 Y207F probably damaging Het
Grip1 A T 10: 119,897,715 D20V probably damaging Het
Gzmf A C 14: 56,206,940 F59V probably damaging Het
Hist1h3a T A 13: 23,761,981 I125F probably damaging Het
Igfn1 T C 1: 135,955,573 I2732V probably benign Het
Ipo8 A T 6: 148,782,728 D855E probably benign Het
Klrk1 A T 6: 129,614,719 probably null Het
Megf11 A G 9: 64,695,412 Y876C probably damaging Het
Mettl8 G T 2: 70,982,151 Q12K probably benign Het
Mrgprf T C 7: 145,308,217 F172S probably benign Het
Mycbp2 G A 14: 103,224,416 T1432I probably damaging Het
Nek11 A C 9: 105,348,061 L84R probably damaging Het
Nlrp1b T C 11: 71,201,273 E9G probably benign Het
Nrxn1 T C 17: 90,037,187 I433V probably damaging Het
Nup153 A G 13: 46,693,974 C660R probably damaging Het
Olfr108 T A 17: 37,446,200 Y226* probably null Het
Olfr1427 G T 19: 12,098,881 P253T probably damaging Het
Olfr196 T A 16: 59,167,901 M81L probably benign Het
Olfr447 T C 6: 42,912,144 V207A possibly damaging Het
P2rx7 T A 5: 122,670,465 N303K possibly damaging Het
Pank4 T C 4: 154,970,047 L159P probably damaging Het
Pcdhb22 A T 18: 37,518,500 H7L probably benign Het
Pdzd8 A T 19: 59,301,339 I543N probably benign Het
Prrc2b C A 2: 32,194,461 R313S probably damaging Het
Rbm12b1 T C 4: 12,145,827 C600R probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rfx6 T A 10: 51,678,402 M113K possibly damaging Het
Rlf A T 4: 121,149,823 D653E probably benign Het
Rnf130 A G 11: 50,087,386 D258G possibly damaging Het
Robo2 A G 16: 73,956,523 V822A possibly damaging Het
Rps6kc1 G T 1: 190,800,336 Q490K possibly damaging Het
Scn9a T C 2: 66,483,506 Y1945C probably damaging Het
Setd2 T A 9: 110,549,857 D913E probably benign Het
Sfr1 G T 19: 47,735,003 E315D possibly damaging Het
Smarca5 G A 8: 80,709,220 R763* probably null Het
Sugct A C 13: 17,672,566 I44S probably damaging Het
Syce1l A G 8: 113,654,030 probably null Het
Tbc1d8b A G X: 139,734,080 I654V probably benign Het
Tcf23 T A 5: 30,973,508 Y163* probably null Het
Terf2ip TG T 8: 112,011,606 probably null Het
Tmem158 T C 9: 123,259,885 S221G possibly damaging Het
Tnrc6a A G 7: 123,169,982 T332A probably benign Het
Trappc4 T C 9: 44,407,211 T31A probably benign Het
Trim27 T C 13: 21,188,065 probably null Het
Ttyh2 T A 11: 114,708,475 L330Q probably damaging Het
Tubgcp3 A T 8: 12,639,532 L578* probably null Het
Txndc11 C A 16: 11,128,701 E83* probably null Het
Utp20 T C 10: 88,749,297 K2635R probably benign Het
V1ra8 C T 6: 90,203,322 T169I probably damaging Het
Vcl G A 14: 21,019,373 V706I probably benign Het
Vmn2r106 A T 17: 20,279,111 D179E probably benign Het
Vmn2r80 T C 10: 79,194,389 M683T probably benign Het
Xirp2 A G 2: 67,509,871 I819V probably benign Het
Zfp735 T C 11: 73,711,763 F511S probably benign Het
Zfp831 T C 2: 174,645,890 V786A probably benign Het
Zfp992 T A 4: 146,466,492 H223Q probably benign Het
Zfyve19 A C 2: 119,210,819 Q72P probably damaging Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTTAGAGGAGCCACTGAACTTCCG -3'
(R):5'- TAATGTAGGAGGACAGCCAGCACC -3'

Sequencing Primer
(F):5'- TGCAGAGTGGCTGGAACTATG -3'
(R):5'- AGGCAAGGCTCAGTTTCTCAG -3'
Posted On2014-05-14