Mutagenetix > Incidental Mutations

Incidental Mutation 'R1709:Smarca5'

190327

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

039742-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1709 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 80709220 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 763 (R763*)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably null
Transcript: ENSMUST00000043359
AA Change: R763*

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: R763*

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122807

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150277

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	C	T	5: 9,440,726	R579*	probably null	Het
Aacs	A	G	5: 125,489,878	K152E	probably benign	Het
Adgrd1	T	C	5: 129,179,228	V641A	possibly damaging	Het
Adgrv1	A	T	13: 81,593,060	V95E	probably damaging	Het
Agbl5	G	A	5: 30,906,241	C872Y	probably damaging	Het
Aldh1a7	G	T	19: 20,715,952	T201K	probably damaging	Het
Aox1	C	T	1: 58,077,474	A788V	probably benign	Het
Apob	T	C	12: 8,009,306	V2563A	probably damaging	Het
Atcay	G	A	10: 81,213,231	T179I	probably damaging	Het
Atf5	A	T	7: 44,813,283	L139Q	probably benign	Het
Atp13a3	T	C	16: 30,315,841	T1205A	probably benign	Het
Atr	C	T	9: 95,871,076	T656I	probably benign	Het
Bloc1s3	T	C	7: 19,507,528	E25G	possibly damaging	Het
Brap	T	C	5: 121,665,290		probably null	Het
C6	G	T	15: 4,790,970	A488S	probably benign	Het
Ccin	T	C	4: 43,984,133	F180S	probably damaging	Het
Cd207	T	C	6: 83,672,836	I256V	possibly damaging	Het
Cdc42bpa	G	T	1: 180,067,224	C323F	probably damaging	Het
Cfap57	T	C	4: 118,571,704	T1022A	probably benign	Het
Cmtr2	A	T	8: 110,221,949	Q297L	probably benign	Het
Coro7	A	T	16: 4,634,441		probably null	Het
Cpsf2	T	A	12: 101,999,542	Y589N	probably damaging	Het
Cpxm2	T	C	7: 132,059,834	Y408C	probably damaging	Het
Crocc	A	G	4: 141,026,099		probably null	Het
Cryzl1	A	C	16: 91,712,236	F59C	probably damaging	Het
Csmd2	T	C	4: 128,496,195	V2241A	probably damaging	Het
Cxcl15	C	A	5: 90,801,416	H147N	unknown	Het
Dennd4a	A	G	9: 64,889,605	T860A	possibly damaging	Het
Dnah10	C	T	5: 124,760,091	P966L	probably damaging	Het
Dpp9	T	A	17: 56,194,431	M594L	probably benign	Het
Dspp	C	A	5: 104,175,724	N244K	probably damaging	Het
Efcab8	T	A	2: 153,814,370		probably null	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fbxw17	A	G	13: 50,431,657	M299V	probably benign	Het
Fbxw7	T	A	3: 84,976,352	I530N	probably damaging	Het
Gm13023	T	C	4: 143,793,546	V120A	possibly damaging	Het
Gp2	C	A	7: 119,451,585	D308Y	probably null	Het
Gpd2	G	A	2: 57,357,655	V537M	probably damaging	Het
Gpr18	T	A	14: 121,911,992	Y207F	probably damaging	Het
Grip1	A	T	10: 119,897,715	D20V	probably damaging	Het
Gzmf	A	C	14: 56,206,940	F59V	probably damaging	Het
Hist1h3a	T	A	13: 23,761,981	I125F	probably damaging	Het
Igfn1	T	C	1: 135,955,573	I2732V	probably benign	Het
Ipo8	A	T	6: 148,782,728	D855E	probably benign	Het
Klrk1	A	T	6: 129,614,719		probably null	Het
Megf11	A	G	9: 64,695,412	Y876C	probably damaging	Het
Mettl8	G	T	2: 70,982,151	Q12K	probably benign	Het
Mrgprf	T	C	7: 145,308,217	F172S	probably benign	Het
Mycbp2	G	A	14: 103,224,416	T1432I	probably damaging	Het
Nek11	A	C	9: 105,348,061	L84R	probably damaging	Het
Nlrp1b	T	C	11: 71,201,273	E9G	probably benign	Het
Nrxn1	T	C	17: 90,037,187	I433V	probably damaging	Het
Nup153	A	G	13: 46,693,974	C660R	probably damaging	Het
Olfr108	T	A	17: 37,446,200	Y226*	probably null	Het
Olfr1427	G	T	19: 12,098,881	P253T	probably damaging	Het
Olfr196	T	A	16: 59,167,901	M81L	probably benign	Het
Olfr447	T	C	6: 42,912,144	V207A	possibly damaging	Het
P2rx7	T	A	5: 122,670,465	N303K	possibly damaging	Het
Pank4	T	C	4: 154,970,047	L159P	probably damaging	Het
Pcdhb22	A	T	18: 37,518,500	H7L	probably benign	Het
Pdzd8	A	T	19: 59,301,339	I543N	probably benign	Het
Prrc2b	C	A	2: 32,194,461	R313S	probably damaging	Het
Rbm12b1	T	C	4: 12,145,827	C600R	probably benign	Het
Rem1	G	A	2: 152,634,535	V238M	probably damaging	Het
Rfx6	T	A	10: 51,678,402	M113K	possibly damaging	Het
Rlf	A	T	4: 121,149,823	D653E	probably benign	Het
Rnf130	A	G	11: 50,087,386	D258G	possibly damaging	Het
Robo2	A	G	16: 73,956,523	V822A	possibly damaging	Het
Rps6kc1	G	T	1: 190,800,336	Q490K	possibly damaging	Het
Scn9a	T	C	2: 66,483,506	Y1945C	probably damaging	Het
Setd2	T	A	9: 110,549,857	D913E	probably benign	Het
Sfr1	G	T	19: 47,735,003	E315D	possibly damaging	Het
Sugct	A	C	13: 17,672,566	I44S	probably damaging	Het
Syce1l	A	G	8: 113,654,030		probably null	Het
Tbc1d8b	A	G	X: 139,734,080	I654V	probably benign	Het
Tcf23	T	A	5: 30,973,508	Y163*	probably null	Het
Terf2ip	TG	T	8: 112,011,606		probably null	Het
Tmem158	T	C	9: 123,259,885	S221G	possibly damaging	Het
Tnrc6a	A	G	7: 123,169,982	T332A	probably benign	Het
Trappc4	T	C	9: 44,407,211	T31A	probably benign	Het
Trim27	T	C	13: 21,188,065		probably null	Het
Ttyh2	T	A	11: 114,708,475	L330Q	probably damaging	Het
Tubgcp3	A	T	8: 12,639,532	L578*	probably null	Het
Txndc11	C	A	16: 11,128,701	E83*	probably null	Het
Utp20	T	C	10: 88,749,297	K2635R	probably benign	Het
V1ra8	C	T	6: 90,203,322	T169I	probably damaging	Het
Vcl	G	A	14: 21,019,373	V706I	probably benign	Het
Vmn2r106	A	T	17: 20,279,111	D179E	probably benign	Het
Vmn2r80	T	C	10: 79,194,389	M683T	probably benign	Het
Xirp2	A	G	2: 67,509,871	I819V	probably benign	Het
Zfp735	T	C	11: 73,711,763	F511S	probably benign	Het
Zfp831	T	C	2: 174,645,890	V786A	probably benign	Het
Zfp992	T	A	4: 146,466,492	H223Q	probably benign	Het
Zfyve19	A	C	2: 119,210,819	Q72P	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCCTTGTGGTCTGAGAAGAAAATG -3'
(R):5'- CGTGTTAGTGAGCCTAAAGCACCC -3'

Sequencing Primer
(F):5'- TGCAAAGAGAAGAATTTGAATCACC -3'
(R):5'- tcagaaatccgcctgcc -3'

Posted On

2014-05-14