Incidental Mutation 'R1709:Adgrv1'
ID190357
Institutional Source Beutler Lab
Gene Symbol Adgrv1
Ensembl Gene ENSMUSG00000069170
Gene Nameadhesion G protein-coupled receptor V1
SynonymsMass1, Mgr1, VLGR1, Gpr98
MMRRC Submission 039742-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1709 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location81095068-81633154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81593060 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 95 (V95E)
Ref Sequence ENSEMBL: ENSMUSP00000114579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095585] [ENSMUST00000126444] [ENSMUST00000128585] [ENSMUST00000146749]
Predicted Effect probably damaging
Transcript: ENSMUST00000095585
AA Change: V95E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093245
Gene: ENSMUSG00000069170
AA Change: V95E

DomainStartEndE-ValueType
Calx_beta 20 116 1.53e-1 SMART
Calx_beta 132 236 1.58e-2 SMART
Calx_beta 251 362 2.33e-2 SMART
Pfam:Calx-beta 380 489 1.1e-3 PFAM
Pfam:Calx-beta 507 616 2.5e-2 PFAM
Pfam:Calx-beta 667 747 9.1e-4 PFAM
Calx_beta 764 862 1.55e-1 SMART
Calx_beta 877 980 1.07e-1 SMART
Calx_beta 994 1094 6.45e-5 SMART
Pfam:Calx-beta 1108 1208 7.4e-4 PFAM
Pfam:Laminin_G_3 1331 1492 4.4e-24 PFAM
Pfam:Calx-beta 1498 1542 6.5e-3 PFAM
Pfam:Calx-beta 1557 1662 1e-6 PFAM
Calx_beta 1706 1805 1.34e-11 SMART
Calx_beta 1846 1948 1.04e-2 SMART
Calx_beta 1962 2075 1.59e-3 SMART
Calx_beta 2103 2202 1.59e-4 SMART
Calx_beta 2218 2320 1.74e-3 SMART
Pfam:Calx-beta 2467 2539 2.1e-4 PFAM
Calx_beta 2576 2672 1.24e-6 SMART
Calx_beta 2687 2786 1.12e-1 SMART
Calx_beta 2810 2921 2.21e-2 SMART
Calx_beta 2945 3044 6.69e-12 SMART
Pfam:Calx-beta 3063 3168 1.2e-5 PFAM
Pfam:Calx-beta 3198 3252 1.2e-1 PFAM
Pfam:EPTP 3391 3434 2.8e-10 PFAM
Pfam:Calx-beta 3577 3623 6.5e-8 PFAM
Pfam:Calx-beta 3637 3737 6e-4 PFAM
Pfam:Calx-beta 3781 3872 6.9e-3 PFAM
Calx_beta 3919 4003 1.18e-2 SMART
Calx_beta 4017 4120 5.44e-2 SMART
Pfam:Calx-beta 4193 4236 2.3e-2 PFAM
Calx_beta 4251 4351 1.43e-20 SMART
Calx_beta 4384 4484 9.46e-3 SMART
Pfam:Calx-beta 4498 4608 2e-2 PFAM
Pfam:Calx-beta 4659 4729 5.1e-2 PFAM
Calx_beta 4989 5089 5.7e-6 SMART
Pfam:Calx-beta 5229 5326 1.9e-6 PFAM
Pfam:Calx-beta 5489 5592 7.2e-5 PFAM
low complexity region 5637 5648 N/A INTRINSIC
GPS 5845 5895 9.48e-3 SMART
Pfam:7tm_2 5902 6141 2.3e-16 PFAM
low complexity region 6227 6240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126444
AA Change: V95E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123552
Gene: ENSMUSG00000069170
AA Change: V95E

DomainStartEndE-ValueType
Blast:Calx_beta 20 116 1e-56 BLAST
Pfam:Calx-beta 132 236 7.6e-11 PFAM
Pfam:Calx-beta 250 362 7.9e-9 PFAM
Blast:Calx_beta 378 489 9e-6 BLAST
low complexity region 531 550 N/A INTRINSIC
Blast:Calx_beta 764 862 2e-59 BLAST
Blast:Calx_beta 877 980 1e-63 BLAST
Pfam:Calx-beta 994 1094 2.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128585
AA Change: V95E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121899
Gene: ENSMUSG00000069170
AA Change: V95E

DomainStartEndE-ValueType
Blast:Calx_beta 20 116 5e-59 BLAST
Pfam:Calx-beta 132 236 4e-11 PFAM
Pfam:Calx-beta 250 362 4.1e-9 PFAM
low complexity region 531 550 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146749
AA Change: V95E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114579
Gene: ENSMUSG00000069170
AA Change: V95E

DomainStartEndE-ValueType
Blast:Calx_beta 20 116 1e-60 BLAST
Pfam:Calx-beta 132 236 3.1e-11 PFAM
Pfam:Calx-beta 250 362 3.1e-9 PFAM
Blast:Calx_beta 378 413 5e-14 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous and a targeted mutation exhibit high sensitivity to audiogenic seizures. Targeted mutant mice lack the ankle links that connect growing stereocilia in the developing cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik C T 5: 9,440,726 R579* probably null Het
Aacs A G 5: 125,489,878 K152E probably benign Het
Adgrd1 T C 5: 129,179,228 V641A possibly damaging Het
Agbl5 G A 5: 30,906,241 C872Y probably damaging Het
Aldh1a7 G T 19: 20,715,952 T201K probably damaging Het
Aox1 C T 1: 58,077,474 A788V probably benign Het
Apob T C 12: 8,009,306 V2563A probably damaging Het
Atcay G A 10: 81,213,231 T179I probably damaging Het
Atf5 A T 7: 44,813,283 L139Q probably benign Het
Atp13a3 T C 16: 30,315,841 T1205A probably benign Het
Atr C T 9: 95,871,076 T656I probably benign Het
Bloc1s3 T C 7: 19,507,528 E25G possibly damaging Het
Brap T C 5: 121,665,290 probably null Het
C6 G T 15: 4,790,970 A488S probably benign Het
Ccin T C 4: 43,984,133 F180S probably damaging Het
Cd207 T C 6: 83,672,836 I256V possibly damaging Het
Cdc42bpa G T 1: 180,067,224 C323F probably damaging Het
Cfap57 T C 4: 118,571,704 T1022A probably benign Het
Cmtr2 A T 8: 110,221,949 Q297L probably benign Het
Coro7 A T 16: 4,634,441 probably null Het
Cpsf2 T A 12: 101,999,542 Y589N probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Crocc A G 4: 141,026,099 probably null Het
Cryzl1 A C 16: 91,712,236 F59C probably damaging Het
Csmd2 T C 4: 128,496,195 V2241A probably damaging Het
Cxcl15 C A 5: 90,801,416 H147N unknown Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dnah10 C T 5: 124,760,091 P966L probably damaging Het
Dpp9 T A 17: 56,194,431 M594L probably benign Het
Dspp C A 5: 104,175,724 N244K probably damaging Het
Efcab8 T A 2: 153,814,370 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw17 A G 13: 50,431,657 M299V probably benign Het
Fbxw7 T A 3: 84,976,352 I530N probably damaging Het
Gm13023 T C 4: 143,793,546 V120A possibly damaging Het
Gp2 C A 7: 119,451,585 D308Y probably null Het
Gpd2 G A 2: 57,357,655 V537M probably damaging Het
Gpr18 T A 14: 121,911,992 Y207F probably damaging Het
Grip1 A T 10: 119,897,715 D20V probably damaging Het
Gzmf A C 14: 56,206,940 F59V probably damaging Het
Hist1h3a T A 13: 23,761,981 I125F probably damaging Het
Igfn1 T C 1: 135,955,573 I2732V probably benign Het
Ipo8 A T 6: 148,782,728 D855E probably benign Het
Klrk1 A T 6: 129,614,719 probably null Het
Megf11 A G 9: 64,695,412 Y876C probably damaging Het
Mettl8 G T 2: 70,982,151 Q12K probably benign Het
Mrgprf T C 7: 145,308,217 F172S probably benign Het
Mycbp2 G A 14: 103,224,416 T1432I probably damaging Het
Nek11 A C 9: 105,348,061 L84R probably damaging Het
Nlrp1b T C 11: 71,201,273 E9G probably benign Het
Nrxn1 T C 17: 90,037,187 I433V probably damaging Het
Nup153 A G 13: 46,693,974 C660R probably damaging Het
Olfr108 T A 17: 37,446,200 Y226* probably null Het
Olfr1427 G T 19: 12,098,881 P253T probably damaging Het
Olfr196 T A 16: 59,167,901 M81L probably benign Het
Olfr447 T C 6: 42,912,144 V207A possibly damaging Het
P2rx7 T A 5: 122,670,465 N303K possibly damaging Het
Pank4 T C 4: 154,970,047 L159P probably damaging Het
Pcdhb22 A T 18: 37,518,500 H7L probably benign Het
Pdzd8 A T 19: 59,301,339 I543N probably benign Het
Prrc2b C A 2: 32,194,461 R313S probably damaging Het
Rbm12b1 T C 4: 12,145,827 C600R probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rfx6 T A 10: 51,678,402 M113K possibly damaging Het
Rlf A T 4: 121,149,823 D653E probably benign Het
Rnf130 A G 11: 50,087,386 D258G possibly damaging Het
Robo2 A G 16: 73,956,523 V822A possibly damaging Het
Rps6kc1 G T 1: 190,800,336 Q490K possibly damaging Het
Scn9a T C 2: 66,483,506 Y1945C probably damaging Het
Setd2 T A 9: 110,549,857 D913E probably benign Het
Sfr1 G T 19: 47,735,003 E315D possibly damaging Het
Smarca5 G A 8: 80,709,220 R763* probably null Het
Sugct A C 13: 17,672,566 I44S probably damaging Het
Syce1l A G 8: 113,654,030 probably null Het
Tbc1d8b A G X: 139,734,080 I654V probably benign Het
Tcf23 T A 5: 30,973,508 Y163* probably null Het
Terf2ip TG T 8: 112,011,606 probably null Het
Tmem158 T C 9: 123,259,885 S221G possibly damaging Het
Tnrc6a A G 7: 123,169,982 T332A probably benign Het
Trappc4 T C 9: 44,407,211 T31A probably benign Het
Trim27 T C 13: 21,188,065 probably null Het
Ttyh2 T A 11: 114,708,475 L330Q probably damaging Het
Tubgcp3 A T 8: 12,639,532 L578* probably null Het
Txndc11 C A 16: 11,128,701 E83* probably null Het
Utp20 T C 10: 88,749,297 K2635R probably benign Het
V1ra8 C T 6: 90,203,322 T169I probably damaging Het
Vcl G A 14: 21,019,373 V706I probably benign Het
Vmn2r106 A T 17: 20,279,111 D179E probably benign Het
Vmn2r80 T C 10: 79,194,389 M683T probably benign Het
Xirp2 A G 2: 67,509,871 I819V probably benign Het
Zfp735 T C 11: 73,711,763 F511S probably benign Het
Zfp831 T C 2: 174,645,890 V786A probably benign Het
Zfp992 T A 4: 146,466,492 H223Q probably benign Het
Zfyve19 A C 2: 119,210,819 Q72P probably damaging Het
Other mutations in Adgrv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgrv1 APN 13 81405408 critical splice acceptor site probably null
IGL00090:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00091:Adgrv1 APN 13 81578101 missense probably damaging 1.00
IGL00332:Adgrv1 APN 13 81472877 splice site probably benign
IGL00471:Adgrv1 APN 13 81509542 missense probably damaging 0.99
IGL00476:Adgrv1 APN 13 81489074 missense probably damaging 0.98
IGL00508:Adgrv1 APN 13 81506187 missense probably damaging 1.00
IGL00727:Adgrv1 APN 13 81524684 missense probably damaging 0.98
IGL00781:Adgrv1 APN 13 81578230 missense probably benign 0.19
IGL00816:Adgrv1 APN 13 81397203 missense probably benign 0.01
IGL00844:Adgrv1 APN 13 81540119 missense probably damaging 1.00
IGL00923:Adgrv1 APN 13 81382291 missense probably damaging 0.99
IGL01113:Adgrv1 APN 13 81489028 missense probably benign 0.00
IGL01143:Adgrv1 APN 13 81419351 missense probably benign 0.00
IGL01151:Adgrv1 APN 13 81405399 missense probably benign 0.00
IGL01153:Adgrv1 APN 13 81419128 missense probably benign 0.01
IGL01363:Adgrv1 APN 13 81557065 missense probably damaging 1.00
IGL01419:Adgrv1 APN 13 81557158 missense probably damaging 0.99
IGL01545:Adgrv1 APN 13 81466184 missense possibly damaging 0.46
IGL01701:Adgrv1 APN 13 81419631 missense possibly damaging 0.55
IGL01796:Adgrv1 APN 13 81567342 missense probably benign 0.01
IGL01816:Adgrv1 APN 13 81529049 missense probably benign 0.00
IGL01871:Adgrv1 APN 13 81472394 critical splice donor site probably null
IGL01955:Adgrv1 APN 13 81182783 missense probably damaging 1.00
IGL01956:Adgrv1 APN 13 81446430 missense possibly damaging 0.63
IGL01988:Adgrv1 APN 13 81557309 missense probably damaging 0.99
IGL01990:Adgrv1 APN 13 81556996 missense probably damaging 1.00
IGL02007:Adgrv1 APN 13 81568743 splice site probably benign
IGL02016:Adgrv1 APN 13 81397453 missense probably damaging 1.00
IGL02095:Adgrv1 APN 13 81579790 missense possibly damaging 0.63
IGL02174:Adgrv1 APN 13 81427664 missense probably benign 0.34
IGL02270:Adgrv1 APN 13 81559195 unclassified probably null
IGL02328:Adgrv1 APN 13 81578175 missense probably damaging 1.00
IGL02350:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02357:Adgrv1 APN 13 81270855 missense probably benign 0.00
IGL02373:Adgrv1 APN 13 81459713 missense possibly damaging 0.90
IGL02402:Adgrv1 APN 13 81559424 missense probably benign 0.18
IGL02407:Adgrv1 APN 13 81479670 missense probably damaging 1.00
IGL02508:Adgrv1 APN 13 81435556 splice site probably benign
IGL02603:Adgrv1 APN 13 81488952 missense possibly damaging 0.93
IGL02648:Adgrv1 APN 13 81511619 missense probably benign 0.35
IGL02720:Adgrv1 APN 13 81578872 missense probably damaging 0.99
IGL02870:Adgrv1 APN 13 81563732 missense probably benign 0.13
IGL02896:Adgrv1 APN 13 81520739 missense probably damaging 1.00
IGL02931:Adgrv1 APN 13 81579714 missense probably damaging 1.00
IGL02952:Adgrv1 APN 13 81433636 missense probably benign 0.00
IGL02961:Adgrv1 APN 13 81523612 missense probably damaging 1.00
IGL02999:Adgrv1 APN 13 81578854 missense probably benign 0.12
IGL03067:Adgrv1 APN 13 81442480 missense probably damaging 1.00
IGL03106:Adgrv1 APN 13 81472899 missense probably benign 0.00
IGL03108:Adgrv1 APN 13 81559529 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81382373 missense probably damaging 1.00
IGL03119:Adgrv1 APN 13 81433700 missense probably benign 0.02
IGL03169:Adgrv1 APN 13 81503900 missense probably damaging 1.00
IGL03186:Adgrv1 APN 13 81433618 missense possibly damaging 0.80
IGL03196:Adgrv1 APN 13 81446478 missense probably benign 0.02
IGL03207:Adgrv1 APN 13 81106898 splice site probably null
IGL03343:Adgrv1 APN 13 81283388 missense probably damaging 1.00
IGL03348:Adgrv1 APN 13 81499058 missense possibly damaging 0.54
IGL03349:Adgrv1 APN 13 81481336 missense probably benign 0.09
IGL03373:Adgrv1 APN 13 81563632 missense probably damaging 0.99
IGL03381:Adgrv1 APN 13 81517967 missense probably damaging 0.99
beatle UTSW 13 81579594 nonsense probably null
Escape UTSW 13 81435705 missense probably benign 0.02
lento UTSW 13 81270897 missense probably damaging 1.00
Metronome UTSW 13 81435559 critical splice donor site probably null
Nome UTSW 13 81391767 missense probably benign 0.00
Propulsion UTSW 13 81475047 missense probably benign 0.06
revulsion UTSW 13 81595182 missense probably damaging 1.00
Saturnv UTSW 13 81531676 missense probably damaging 1.00
Thrust UTSW 13 81374256 missense probably benign 0.01
Velocity UTSW 13 81397354 missense probably benign 0.00
Wilting UTSW 13 81492501 missense probably benign 0.02
Withering UTSW 13 81494657 missense probably damaging 1.00
F2404:Adgrv1 UTSW 13 81420006 missense probably benign 0.13
I2288:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
I2289:Adgrv1 UTSW 13 81437524 missense probably damaging 1.00
PIT4377001:Adgrv1 UTSW 13 81528985 missense probably damaging 1.00
PIT4504001:Adgrv1 UTSW 13 81559352 missense probably damaging 0.99
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0017:Adgrv1 UTSW 13 81578946 missense probably benign 0.13
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0058:Adgrv1 UTSW 13 81182672 missense possibly damaging 0.65
R0083:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0087:Adgrv1 UTSW 13 81386951 missense probably damaging 1.00
R0108:Adgrv1 UTSW 13 81578404 unclassified probably benign
R0131:Adgrv1 UTSW 13 81502995 unclassified probably benign
R0218:Adgrv1 UTSW 13 81106898 splice site probably null
R0325:Adgrv1 UTSW 13 81540015 missense probably damaging 1.00
R0326:Adgrv1 UTSW 13 81474993 missense possibly damaging 0.46
R0395:Adgrv1 UTSW 13 81385953 missense probably benign 0.00
R0441:Adgrv1 UTSW 13 81397226 nonsense probably null
R0466:Adgrv1 UTSW 13 81566296 missense probably benign 0.00
R0487:Adgrv1 UTSW 13 81489035 missense probably damaging 1.00
R0501:Adgrv1 UTSW 13 81559150 missense probably damaging 1.00
R0522:Adgrv1 UTSW 13 81528442 splice site probably benign
R0532:Adgrv1 UTSW 13 81578896 missense probably damaging 1.00
R0542:Adgrv1 UTSW 13 81573318 missense probably damaging 1.00
R0681:Adgrv1 UTSW 13 81528530 missense probably damaging 1.00
R0689:Adgrv1 UTSW 13 81475105 missense possibly damaging 0.47
R0732:Adgrv1 UTSW 13 81503004 missense possibly damaging 0.86
R0746:Adgrv1 UTSW 13 81570556 missense probably benign 0.10
R0763:Adgrv1 UTSW 13 81499125 missense probably damaging 0.98
R0846:Adgrv1 UTSW 13 81479742 nonsense probably null
R0962:Adgrv1 UTSW 13 81405346 missense probably benign 0.01
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1146:Adgrv1 UTSW 13 81531676 missense probably damaging 1.00
R1172:Adgrv1 UTSW 13 81557063 missense probably damaging 0.98
R1178:Adgrv1 UTSW 13 81440037 splice site probably benign
R1310:Adgrv1 UTSW 13 81566377 missense probably benign 0.09
R1386:Adgrv1 UTSW 13 81528865 missense probably benign 0.17
R1387:Adgrv1 UTSW 13 81493176 missense possibly damaging 0.62
R1395:Adgrv1 UTSW 13 81386788 missense probably benign 0.05
R1412:Adgrv1 UTSW 13 81095450 missense probably damaging 1.00
R1448:Adgrv1 UTSW 13 81433513 missense probably benign 0.08
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1470:Adgrv1 UTSW 13 81382298 missense probably benign 0.03
R1485:Adgrv1 UTSW 13 81579619 missense probably damaging 1.00
R1507:Adgrv1 UTSW 13 81472580 critical splice acceptor site probably null
R1513:Adgrv1 UTSW 13 81556957 missense probably damaging 1.00
R1513:Adgrv1 UTSW 13 81593048 missense probably damaging 1.00
R1539:Adgrv1 UTSW 13 81503978 unclassified probably null
R1579:Adgrv1 UTSW 13 81563779 missense probably damaging 1.00
R1580:Adgrv1 UTSW 13 81466160 critical splice donor site probably null
R1611:Adgrv1 UTSW 13 81559117 missense probably damaging 1.00
R1615:Adgrv1 UTSW 13 81424288 missense probably benign 0.41
R1651:Adgrv1 UTSW 13 81487853 missense probably benign 0.19
R1660:Adgrv1 UTSW 13 81476631 missense probably benign 0.00
R1679:Adgrv1 UTSW 13 81559552 missense probably damaging 1.00
R1735:Adgrv1 UTSW 13 81487947 missense possibly damaging 0.62
R1762:Adgrv1 UTSW 13 81506146 missense probably benign 0.08
R1830:Adgrv1 UTSW 13 81489077 missense possibly damaging 0.65
R1836:Adgrv1 UTSW 13 81504113 missense probably benign 0.01
R1843:Adgrv1 UTSW 13 81544533 missense probably damaging 1.00
R1863:Adgrv1 UTSW 13 81563566 missense probably damaging 1.00
R1895:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1907:Adgrv1 UTSW 13 81592551 splice site probably benign
R1928:Adgrv1 UTSW 13 81520786 missense probably benign 0.00
R1938:Adgrv1 UTSW 13 81391757 missense probably damaging 0.99
R1944:Adgrv1 UTSW 13 81510911 missense probably damaging 1.00
R1946:Adgrv1 UTSW 13 81374249 missense probably damaging 1.00
R1984:Adgrv1 UTSW 13 81523749 missense probably damaging 1.00
R2027:Adgrv1 UTSW 13 81595182 missense probably damaging 1.00
R2063:Adgrv1 UTSW 13 81561469 missense possibly damaging 0.81
R2116:Adgrv1 UTSW 13 81529013 missense probably benign 0.11
R2117:Adgrv1 UTSW 13 81492537 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419535 missense probably benign 0.00
R2125:Adgrv1 UTSW 13 81419950 missense probably benign 0.02
R2127:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2128:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2129:Adgrv1 UTSW 13 81557080 missense probably damaging 1.00
R2130:Adgrv1 UTSW 13 81581727 missense possibly damaging 0.61
R2135:Adgrv1 UTSW 13 81524557 critical splice donor site probably null
R2138:Adgrv1 UTSW 13 81445320 missense probably benign 0.00
R2166:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R2171:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R2191:Adgrv1 UTSW 13 81566290 missense possibly damaging 0.90
R2256:Adgrv1 UTSW 13 81506140 missense probably benign
R2260:Adgrv1 UTSW 13 81568374 missense probably damaging 0.97
R2323:Adgrv1 UTSW 13 81595179 missense probably damaging 1.00
R2432:Adgrv1 UTSW 13 81540132 frame shift probably null
R2910:Adgrv1 UTSW 13 81557119 missense possibly damaging 0.61
R2920:Adgrv1 UTSW 13 81448865 missense probably benign 0.01
R2989:Adgrv1 UTSW 13 81581747 missense probably damaging 1.00
R3402:Adgrv1 UTSW 13 81543542 missense probably damaging 1.00
R3692:Adgrv1 UTSW 13 81524600 missense possibly damaging 0.91
R3711:Adgrv1 UTSW 13 81419475 missense probably benign 0.02
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3732:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3733:Adgrv1 UTSW 13 81556956 missense probably damaging 1.00
R3773:Adgrv1 UTSW 13 81499043 missense probably damaging 0.98
R3791:Adgrv1 UTSW 13 81593102 missense probably damaging 1.00
R3794:Adgrv1 UTSW 13 81283367 start codon destroyed probably damaging 1.00
R3848:Adgrv1 UTSW 13 81440072 missense probably damaging 0.97
R3880:Adgrv1 UTSW 13 81435705 missense probably benign 0.02
R3925:Adgrv1 UTSW 13 81578772 missense possibly damaging 0.89
R3934:Adgrv1 UTSW 13 81475047 missense probably benign 0.06
R3942:Adgrv1 UTSW 13 81182789 missense probably damaging 1.00
R4002:Adgrv1 UTSW 13 81540132 frame shift probably null
R4003:Adgrv1 UTSW 13 81540132 frame shift probably null
R4194:Adgrv1 UTSW 13 81498996 missense probably damaging 0.98
R4308:Adgrv1 UTSW 13 81440192 missense probably damaging 0.96
R4368:Adgrv1 UTSW 13 81492910 missense unknown
R4388:Adgrv1 UTSW 13 81581709 missense probably damaging 0.98
R4421:Adgrv1 UTSW 13 81566302 missense probably damaging 1.00
R4468:Adgrv1 UTSW 13 81374256 missense probably benign 0.01
R4483:Adgrv1 UTSW 13 81419230 missense probably benign 0.01
R4487:Adgrv1 UTSW 13 81440066 missense probably damaging 0.99
R4566:Adgrv1 UTSW 13 81419808 missense probably damaging 1.00
R4615:Adgrv1 UTSW 13 81494569 splice site probably null
R4647:Adgrv1 UTSW 13 81528795 nonsense probably null
R4657:Adgrv1 UTSW 13 81405364 missense probably benign 0.01
R4723:Adgrv1 UTSW 13 81433525 missense probably benign 0.02
R4765:Adgrv1 UTSW 13 81106919 missense probably damaging 0.99
R4783:Adgrv1 UTSW 13 81095445 missense probably damaging 0.99
R4796:Adgrv1 UTSW 13 81155231 nonsense probably null
R4816:Adgrv1 UTSW 13 81528674 missense probably damaging 1.00
R4833:Adgrv1 UTSW 13 81560844 missense possibly damaging 0.81
R4841:Adgrv1 UTSW 13 81503001 critical splice donor site probably null
R4871:Adgrv1 UTSW 13 81533122 intron probably benign
R4897:Adgrv1 UTSW 13 81561585 splice site probably null
R4906:Adgrv1 UTSW 13 81270738 splice site probably null
R4917:Adgrv1 UTSW 13 81510877 missense probably benign 0.30
R4996:Adgrv1 UTSW 13 81578734 missense probably benign 0.01
R5030:Adgrv1 UTSW 13 81459829 missense probably benign 0.43
R5044:Adgrv1 UTSW 13 81488931 missense probably benign 0.01
R5052:Adgrv1 UTSW 13 81528821 missense probably damaging 0.97
R5093:Adgrv1 UTSW 13 81592585 missense probably damaging 1.00
R5095:Adgrv1 UTSW 13 81095487 missense probably benign 0.00
R5119:Adgrv1 UTSW 13 81419427 missense possibly damaging 0.93
R5133:Adgrv1 UTSW 13 81439441 missense probably damaging 1.00
R5141:Adgrv1 UTSW 13 81270918 missense probably damaging 1.00
R5164:Adgrv1 UTSW 13 81435674 missense probably benign 0.00
R5180:Adgrv1 UTSW 13 81283416 start gained probably benign
R5203:Adgrv1 UTSW 13 81510905 missense possibly damaging 0.91
R5241:Adgrv1 UTSW 13 81488929 nonsense probably null
R5280:Adgrv1 UTSW 13 81397465 missense possibly damaging 0.95
R5289:Adgrv1 UTSW 13 81521084 missense probably benign 0.04
R5304:Adgrv1 UTSW 13 81578253 missense possibly damaging 0.93
R5310:Adgrv1 UTSW 13 81476690 missense possibly damaging 0.95
R5338:Adgrv1 UTSW 13 81529046 missense possibly damaging 0.80
R5352:Adgrv1 UTSW 13 81494657 missense probably damaging 1.00
R5402:Adgrv1 UTSW 13 81459715 missense probably benign 0.25
R5418:Adgrv1 UTSW 13 81419308 missense probably benign 0.01
R5460:Adgrv1 UTSW 13 81424258 missense possibly damaging 0.95
R5510:Adgrv1 UTSW 13 81445244 missense probably damaging 1.00
R5521:Adgrv1 UTSW 13 81419389 missense probably benign 0.01
R5538:Adgrv1 UTSW 13 81433689 missense probably benign 0.02
R5561:Adgrv1 UTSW 13 81476564 missense probably damaging 0.99
R5584:Adgrv1 UTSW 13 81405267 missense probably damaging 1.00
R5608:Adgrv1 UTSW 13 81155276 missense probably damaging 1.00
R5610:Adgrv1 UTSW 13 81521117 missense probably damaging 1.00
R5619:Adgrv1 UTSW 13 81472500 missense probably damaging 1.00
R5751:Adgrv1 UTSW 13 81522236 missense probably damaging 1.00
R5832:Adgrv1 UTSW 13 81103302 missense possibly damaging 0.95
R5885:Adgrv1 UTSW 13 81424271 missense probably benign 0.15
R5930:Adgrv1 UTSW 13 81397451 missense probably benign 0.06
R5937:Adgrv1 UTSW 13 81107075 missense probably damaging 0.96
R5943:Adgrv1 UTSW 13 81386866 missense probably damaging 0.98
R5951:Adgrv1 UTSW 13 81442501 missense probably damaging 1.00
R5977:Adgrv1 UTSW 13 81435559 critical splice donor site probably null
R5995:Adgrv1 UTSW 13 81466259 missense probably benign 0.03
R6017:Adgrv1 UTSW 13 81397423 nonsense probably null
R6024:Adgrv1 UTSW 13 81476505 missense probably benign 0.26
R6049:Adgrv1 UTSW 13 81397354 missense probably benign 0.00
R6108:Adgrv1 UTSW 13 81391695 missense probably damaging 0.99
R6130:Adgrv1 UTSW 13 81427745 missense probably damaging 0.99
R6132:Adgrv1 UTSW 13 81506076 missense probably benign 0.04
R6149:Adgrv1 UTSW 13 81182774 missense probably damaging 1.00
R6169:Adgrv1 UTSW 13 81419259 missense probably benign 0.00
R6175:Adgrv1 UTSW 13 81386005 missense probably damaging 1.00
R6184:Adgrv1 UTSW 13 81433838 missense probably benign 0.01
R6190:Adgrv1 UTSW 13 81459763 synonymous probably null
R6190:Adgrv1 UTSW 13 81524779 splice site probably null
R6215:Adgrv1 UTSW 13 81579594 nonsense probably null
R6216:Adgrv1 UTSW 13 81524471 intron probably null
R6238:Adgrv1 UTSW 13 81466283 missense probably benign 0.07
R6244:Adgrv1 UTSW 13 81106931 missense probably damaging 1.00
R6298:Adgrv1 UTSW 13 81391767 missense probably benign 0.00
R6316:Adgrv1 UTSW 13 81499068 missense possibly damaging 0.63
R6336:Adgrv1 UTSW 13 81385981 missense probably benign 0.09
R6358:Adgrv1 UTSW 13 81414583 missense probably damaging 0.99
R6421:Adgrv1 UTSW 13 81508736 missense possibly damaging 0.69
R6466:Adgrv1 UTSW 13 81575101 unclassified probably null
R6467:Adgrv1 UTSW 13 81444538 missense probably benign 0.01
R6510:Adgrv1 UTSW 13 81559490 missense possibly damaging 0.88
R6519:Adgrv1 UTSW 13 81567343 missense probably benign 0.01
R6521:Adgrv1 UTSW 13 81433652 missense probably damaging 1.00
R6598:Adgrv1 UTSW 13 81506179 missense probably damaging 1.00
R6605:Adgrv1 UTSW 13 81487962 missense possibly damaging 0.80
R6626:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R6633:Adgrv1 UTSW 13 81568643 missense probably damaging 1.00
R6721:Adgrv1 UTSW 13 81481515 missense probably benign 0.00
R6725:Adgrv1 UTSW 13 81437557 missense probably damaging 0.99
R6725:Adgrv1 UTSW 13 81493210 missense probably damaging 1.00
R6796:Adgrv1 UTSW 13 81472478 missense probably damaging 1.00
R6809:Adgrv1 UTSW 13 81472953 missense probably benign 0.01
R6823:Adgrv1 UTSW 13 81557081 missense probably damaging 1.00
R6876:Adgrv1 UTSW 13 81155154 critical splice donor site probably null
R6878:Adgrv1 UTSW 13 81433494 missense probably benign 0.06
R6887:Adgrv1 UTSW 13 81528701 missense probably benign 0.01
R6888:Adgrv1 UTSW 13 81508669 missense probably damaging 1.00
R6957:Adgrv1 UTSW 13 81567490 missense probably benign 0.00
R6976:Adgrv1 UTSW 13 81520997 missense probably damaging 1.00
R7003:Adgrv1 UTSW 13 81522104 critical splice donor site probably null
R7007:Adgrv1 UTSW 13 81536364 missense possibly damaging 0.80
R7073:Adgrv1 UTSW 13 81561474 missense probably damaging 1.00
R7100:Adgrv1 UTSW 13 81270897 missense probably damaging 1.00
R7107:Adgrv1 UTSW 13 81578142 missense probably benign 0.13
R7123:Adgrv1 UTSW 13 81592574 missense probably damaging 1.00
R7141:Adgrv1 UTSW 13 81492501 missense probably benign 0.02
R7168:Adgrv1 UTSW 13 81397209 missense possibly damaging 0.52
R7205:Adgrv1 UTSW 13 81479658 missense probably benign 0.00
R7239:Adgrv1 UTSW 13 81476612 missense possibly damaging 0.69
R7249:Adgrv1 UTSW 13 81374259 missense probably damaging 1.00
R7313:Adgrv1 UTSW 13 81520515 missense possibly damaging 0.95
R7376:Adgrv1 UTSW 13 81518126 missense probably damaging 1.00
R7392:Adgrv1 UTSW 13 81560689 missense probably damaging 1.00
R7395:Adgrv1 UTSW 13 81559348 missense probably damaging 1.00
R7410:Adgrv1 UTSW 13 81563619 missense probably benign 0.04
R7449:Adgrv1 UTSW 13 81499073 missense probably damaging 0.99
R7496:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7497:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7498:Adgrv1 UTSW 13 81440225 missense possibly damaging 0.79
R7567:Adgrv1 UTSW 13 81433529 missense probably benign 0.00
R7567:Adgrv1 UTSW 13 81579477 missense probably damaging 1.00
R7614:Adgrv1 UTSW 13 81520661 missense probably damaging 1.00
R7623:Adgrv1 UTSW 13 81422225 missense possibly damaging 0.77
R7665:Adgrv1 UTSW 13 81499142 missense probably damaging 1.00
R7685:Adgrv1 UTSW 13 81103324 missense possibly damaging 0.94
X0054:Adgrv1 UTSW 13 81559270 missense probably damaging 1.00
X0062:Adgrv1 UTSW 13 81386926 missense probably damaging 0.99
X0067:Adgrv1 UTSW 13 81543392 missense possibly damaging 0.51
Z1088:Adgrv1 UTSW 13 81476672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTGTCACAGAAGCAGCCCTTG -3'
(R):5'- GACAGTGCCACTTGATCTGTACCC -3'

Sequencing Primer
(F):5'- TGTATCTACTAGCCAGGAGCAC -3'
(R):5'- CTTTCTTCTGGTTGCTCCAATGAG -3'
Posted On2014-05-14