Incidental Mutation 'R1710:Zfp142'
ID190386
Institutional Source Beutler Lab
Gene Symbol Zfp142
Ensembl Gene ENSMUSG00000026135
Gene Namezinc finger protein 142
Synonyms9330177B18Rik
MMRRC Submission 039743-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1710 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74565127-74588246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74572230 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 601 (D601V)
Ref Sequence ENSEMBL: ENSMUSP00000065149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027315] [ENSMUST00000066986] [ENSMUST00000067916] [ENSMUST00000113737] [ENSMUST00000113749] [ENSMUST00000127921] [ENSMUST00000141412] [ENSMUST00000156613]
Predicted Effect probably damaging
Transcript: ENSMUST00000027315
AA Change: D802V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027315
Gene: ENSMUSG00000026135
AA Change: D802V

DomainStartEndE-ValueType
ZnF_C2H2 103 127 1.16e1 SMART
ZnF_C2H2 164 186 1.26e-2 SMART
ZnF_C2H2 193 218 7.78e-3 SMART
ZnF_C2H2 223 247 2.29e0 SMART
ZnF_C2H2 250 272 9.96e-1 SMART
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 363 385 9.96e-1 SMART
ZnF_C2H2 391 411 1.26e1 SMART
ZnF_C2H2 419 442 1.47e-3 SMART
ZnF_C2H2 453 475 2.75e-3 SMART
ZnF_C2H2 486 511 3.34e-2 SMART
ZnF_C2H2 516 540 4.81e0 SMART
ZnF_C2H2 543 566 7.05e-1 SMART
ZnF_C2H2 572 595 2.17e-1 SMART
ZnF_C2H2 601 623 1.56e-2 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 657 679 1.38e-3 SMART
ZnF_C2H2 685 707 9.44e-2 SMART
ZnF_C2H2 712 735 1.26e-2 SMART
ZnF_C2H2 744 767 1.31e0 SMART
ZnF_C2H2 773 796 2.63e0 SMART
low complexity region 903 919 N/A INTRINSIC
low complexity region 953 969 N/A INTRINSIC
low complexity region 996 1007 N/A INTRINSIC
ZnF_C2H2 1039 1059 2.01e1 SMART
ZnF_C2H2 1069 1089 1.91e1 SMART
low complexity region 1147 1160 N/A INTRINSIC
ZnF_C2H2 1187 1207 2.7e2 SMART
low complexity region 1209 1222 N/A INTRINSIC
ZnF_C2H2 1265 1285 3.56e1 SMART
ZnF_C2H2 1295 1318 4.98e-1 SMART
ZnF_C2H2 1331 1354 2.49e-1 SMART
ZnF_C2H2 1360 1382 1.03e-2 SMART
ZnF_C2H2 1388 1411 5.72e-1 SMART
ZnF_C2H2 1417 1440 6.75e0 SMART
ZnF_C2H2 1446 1469 9.58e-3 SMART
ZnF_C2H2 1488 1511 1.64e-1 SMART
ZnF_C2H2 1514 1536 1.1e-2 SMART
ZnF_C2H2 1540 1563 4.05e-1 SMART
ZnF_C2H2 1580 1602 4.45e0 SMART
ZnF_C2H2 1608 1630 8.81e-2 SMART
ZnF_C2H2 1636 1658 1.18e-2 SMART
ZnF_C2H2 1664 1686 1.2e-3 SMART
ZnF_C2H2 1692 1715 3.89e-3 SMART
ZnF_C2H2 1721 1743 4.54e-4 SMART
ZnF_C2H2 1749 1771 1.18e-2 SMART
ZnF_C2H2 1777 1799 3.52e-1 SMART
low complexity region 1829 1838 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066986
AA Change: D601V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065149
Gene: ENSMUSG00000026135
AA Change: D601V

DomainStartEndE-ValueType
low complexity region 116 128 N/A INTRINSIC
ZnF_C2H2 162 184 9.96e-1 SMART
ZnF_C2H2 190 210 1.26e1 SMART
ZnF_C2H2 218 241 1.47e-3 SMART
ZnF_C2H2 252 274 2.75e-3 SMART
ZnF_C2H2 285 310 3.34e-2 SMART
ZnF_C2H2 315 339 4.81e0 SMART
ZnF_C2H2 342 365 7.05e-1 SMART
ZnF_C2H2 371 394 2.17e-1 SMART
ZnF_C2H2 400 422 1.56e-2 SMART
ZnF_C2H2 428 450 8.94e-3 SMART
ZnF_C2H2 456 478 1.38e-3 SMART
ZnF_C2H2 484 506 9.44e-2 SMART
ZnF_C2H2 511 534 1.26e-2 SMART
ZnF_C2H2 543 566 1.31e0 SMART
ZnF_C2H2 572 595 2.63e0 SMART
low complexity region 702 718 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
ZnF_C2H2 838 858 2.01e1 SMART
ZnF_C2H2 868 888 1.91e1 SMART
low complexity region 946 959 N/A INTRINSIC
ZnF_C2H2 986 1006 2.7e2 SMART
low complexity region 1008 1021 N/A INTRINSIC
ZnF_C2H2 1064 1084 3.56e1 SMART
ZnF_C2H2 1094 1117 4.98e-1 SMART
ZnF_C2H2 1130 1153 2.49e-1 SMART
ZnF_C2H2 1159 1181 1.03e-2 SMART
ZnF_C2H2 1187 1210 5.72e-1 SMART
ZnF_C2H2 1216 1239 6.75e0 SMART
ZnF_C2H2 1245 1268 9.58e-3 SMART
ZnF_C2H2 1287 1310 1.64e-1 SMART
ZnF_C2H2 1313 1335 1.1e-2 SMART
ZnF_C2H2 1339 1362 4.05e-1 SMART
ZnF_C2H2 1379 1401 4.45e0 SMART
ZnF_C2H2 1407 1429 8.81e-2 SMART
ZnF_C2H2 1435 1457 1.18e-2 SMART
ZnF_C2H2 1463 1485 1.2e-3 SMART
ZnF_C2H2 1491 1514 3.89e-3 SMART
ZnF_C2H2 1520 1542 4.54e-4 SMART
ZnF_C2H2 1548 1570 1.18e-2 SMART
ZnF_C2H2 1576 1598 3.52e-1 SMART
low complexity region 1628 1637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067916
SMART Domains Protein: ENSMUSP00000064413
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113737
AA Change: D699V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109366
Gene: ENSMUSG00000026135
AA Change: D699V

DomainStartEndE-ValueType
ZnF_C2H2 93 115 9.81e1 SMART
ZnF_C2H2 120 144 2.29e0 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
low complexity region 214 226 N/A INTRINSIC
ZnF_C2H2 260 282 9.96e-1 SMART
ZnF_C2H2 288 308 1.26e1 SMART
ZnF_C2H2 316 339 1.47e-3 SMART
ZnF_C2H2 350 372 2.75e-3 SMART
ZnF_C2H2 383 408 3.34e-2 SMART
ZnF_C2H2 413 437 4.81e0 SMART
ZnF_C2H2 440 463 7.05e-1 SMART
ZnF_C2H2 469 492 2.17e-1 SMART
ZnF_C2H2 498 520 1.56e-2 SMART
ZnF_C2H2 526 548 8.94e-3 SMART
ZnF_C2H2 554 576 1.38e-3 SMART
ZnF_C2H2 582 604 9.44e-2 SMART
ZnF_C2H2 609 632 1.26e-2 SMART
ZnF_C2H2 641 664 1.31e0 SMART
ZnF_C2H2 670 693 2.63e0 SMART
low complexity region 800 816 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
ZnF_C2H2 936 956 2.01e1 SMART
ZnF_C2H2 966 986 1.91e1 SMART
low complexity region 1044 1057 N/A INTRINSIC
ZnF_C2H2 1084 1104 2.7e2 SMART
low complexity region 1106 1119 N/A INTRINSIC
ZnF_C2H2 1162 1182 3.56e1 SMART
ZnF_C2H2 1192 1215 4.98e-1 SMART
ZnF_C2H2 1228 1251 2.49e-1 SMART
ZnF_C2H2 1257 1279 1.03e-2 SMART
ZnF_C2H2 1285 1308 5.72e-1 SMART
ZnF_C2H2 1314 1337 6.75e0 SMART
ZnF_C2H2 1343 1366 9.58e-3 SMART
ZnF_C2H2 1385 1408 1.64e-1 SMART
ZnF_C2H2 1411 1433 1.1e-2 SMART
ZnF_C2H2 1437 1460 4.05e-1 SMART
ZnF_C2H2 1477 1499 4.45e0 SMART
ZnF_C2H2 1505 1527 8.81e-2 SMART
ZnF_C2H2 1533 1555 1.18e-2 SMART
ZnF_C2H2 1561 1583 1.2e-3 SMART
ZnF_C2H2 1589 1612 3.89e-3 SMART
ZnF_C2H2 1618 1640 4.54e-4 SMART
ZnF_C2H2 1646 1668 1.18e-2 SMART
ZnF_C2H2 1674 1696 3.52e-1 SMART
low complexity region 1726 1735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113749
SMART Domains Protein: ENSMUSP00000109378
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127921
Predicted Effect probably benign
Transcript: ENSMUST00000141412
SMART Domains Protein: ENSMUSP00000115322
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156613
Meta Mutation Damage Score 0.5114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (117/120)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kruppel family of C2H2-type zinc finger proteins. It contains 31 C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,468,063 S249R possibly damaging Het
9130409I23Rik A G 1: 181,051,319 M1V probably null Het
Acadvl T A 11: 70,010,355 I638F probably damaging Het
Acnat2 T A 4: 49,380,587 T264S probably benign Het
Acrv1 C T 9: 36,694,255 Q33* probably null Het
Actrt3 T A 3: 30,599,752 N33I probably damaging Het
Alyref2 T C 1: 171,503,600 probably benign Het
Ank2 C A 3: 126,933,060 E3712* probably null Het
Ano7 C A 1: 93,385,624 H161Q probably benign Het
Arhgap10 C A 8: 77,358,587 E451* probably null Het
Arhgap29 T A 3: 122,008,080 Y748N probably damaging Het
Arhgap45 C T 10: 80,018,098 Q149* probably null Het
Asap2 C T 12: 21,224,392 H371Y probably damaging Het
Atp6v1b1 T C 6: 83,758,390 I480T probably benign Het
BC034090 T C 1: 155,225,864 D218G possibly damaging Het
Brdt A T 5: 107,343,584 D74V probably damaging Het
C4b A G 17: 34,743,664 probably benign Het
Card11 T A 5: 140,902,905 K233* probably null Het
Catip T G 1: 74,362,770 F35V possibly damaging Het
Ccdc13 C T 9: 121,819,581 G247R probably damaging Het
Cep97 T A 16: 55,915,022 D471V probably damaging Het
Col17a1 A T 19: 47,670,931 L403Q probably damaging Het
Crbn A G 6: 106,790,945 S194P possibly damaging Het
Dhx58 T A 11: 100,703,574 H97L probably benign Het
Dnah8 T C 17: 30,854,940 I4528T probably damaging Het
Dpyd A G 3: 118,610,443 probably null Het
Entpd1 A T 19: 40,726,236 Q263L probably benign Het
Esyt3 T C 9: 99,336,191 I130M probably benign Het
Etv1 T C 12: 38,852,262 F264S probably benign Het
Fam189a2 A T 19: 23,979,695 I317N probably damaging Het
Fam196b T A 11: 34,404,263 probably null Het
Fam45a A G 19: 60,817,583 Y102C probably damaging Het
Fat1 T C 8: 45,010,482 S1354P probably benign Het
Fat4 C A 3: 38,951,155 T1901N probably damaging Het
Fbxw13 C T 9: 109,181,518 V351I probably damaging Het
Fmo3 A G 1: 162,967,787 F160L possibly damaging Het
Fyb2 T A 4: 105,003,916 D592E probably damaging Het
Gjb4 T C 4: 127,351,870 M93V possibly damaging Het
Gm5089 C A 14: 122,436,154 G52* probably null Het
Gm6401 G T 14: 41,966,883 N76K probably benign Het
Gm6871 A G 7: 41,546,477 S279P probably damaging Het
Gtf2ird2 T G 5: 134,211,240 V301G probably benign Het
H2bfm A C X: 136,927,467 D35A unknown Het
Hfm1 A G 5: 106,880,514 F817L probably damaging Het
Hfm1 T C 5: 106,896,003 E589G probably damaging Het
Hivep2 A T 10: 14,129,505 K616* probably null Het
Hmcn1 A T 1: 150,675,984 I2623N probably damaging Het
Igf2bp3 G T 6: 49,105,631 A339E probably damaging Het
Irx4 T C 13: 73,267,638 I182T possibly damaging Het
Jcad T C 18: 4,674,511 S758P probably damaging Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Lama1 A G 17: 67,753,791 I705V probably benign Het
Mbd5 A G 2: 49,257,032 N418S probably benign Het
Mmp21 C T 7: 133,677,285 V279I probably damaging Het
Morc4 A C X: 139,854,530 C272W probably damaging Het
Mrm1 A T 11: 84,818,692 C180S probably damaging Het
Ncor1 T C 11: 62,423,005 D103G probably damaging Het
Ndrg4 A G 8: 95,710,686 D251G probably damaging Het
Ndufaf5 T C 2: 140,193,602 V246A possibly damaging Het
Noa1 T C 5: 77,309,725 E111G possibly damaging Het
Nod1 C A 6: 54,944,059 V425F probably damaging Het
Nos1 A T 5: 117,895,919 I369F probably damaging Het
Nsun5 C T 5: 135,371,316 H98Y probably damaging Het
Olfr1013 C T 2: 85,769,855 T18I probably benign Het
Olfr172 A G 16: 58,761,141 F12L probably benign Het
Olfr292 G A 7: 86,695,110 R218H probably benign Het
Olfr726 C G 14: 50,084,370 V104L probably benign Het
Olfr933 A G 9: 38,975,906 I77V probably damaging Het
Olfr945 T C 9: 39,258,571 I37V probably benign Het
Optn G A 2: 5,053,130 T76I possibly damaging Het
Oscar C T 7: 3,611,856 W22* probably null Het
Palmd T A 3: 116,923,657 Y397F probably damaging Het
Plk1 A G 7: 122,168,898 D447G probably damaging Het
Plscr5 T A 9: 92,205,528 N183K probably damaging Het
Polk T G 13: 96,489,204 D364A probably damaging Het
Polr3d T C 14: 70,443,010 T36A probably benign Het
Ppp1r10 A T 17: 35,926,536 R199S probably damaging Het
Prkcz C T 4: 155,262,512 D388N probably damaging Het
Prrc2b T C 2: 32,212,222 L769P probably damaging Het
Psg26 A G 7: 18,480,041 V232A probably damaging Het
Pth2r T C 1: 65,336,838 V85A possibly damaging Het
Rbpms2 T C 9: 65,659,212 probably benign Het
Reps1 A T 10: 18,118,950 D514V possibly damaging Het
Riok3 G T 18: 12,142,961 R238L probably benign Het
Rnf19a T C 15: 36,244,207 Q569R probably damaging Het
Rorb G A 19: 18,960,501 T267I probably damaging Het
Rrm2b A T 15: 37,929,096 M70K probably damaging Het
Rsf1 A T 7: 97,662,349 E762V possibly damaging Het
S100a2 G A 3: 90,591,392 V67I probably benign Het
Skp1a T A 11: 52,242,615 D42E probably benign Het
Slc22a4 A T 11: 54,027,975 M1K probably null Het
Slc2a9 T A 5: 38,382,044 Q371L probably damaging Het
Slc4a9 A G 18: 36,532,022 T475A probably benign Het
Slc8b1 A G 5: 120,519,652 N60S probably damaging Het
Slx4 A C 16: 3,999,158 D66E probably benign Het
Smg8 A T 11: 87,086,287 I156N probably damaging Het
Snx25 A T 8: 46,116,207 C218S possibly damaging Het
Sulf2 T C 2: 166,079,072 I784V probably benign Het
Tatdn2 G T 6: 113,697,927 R72L possibly damaging Het
Tbc1d8 T C 1: 39,406,837 D91G possibly damaging Het
Tifab C A 13: 56,176,620 R3S probably benign Het
Tm4sf1 A T 3: 57,292,883 S104T probably damaging Het
Tmem132e T A 11: 82,443,517 I618N probably damaging Het
Ttc7b A T 12: 100,403,408 D367E probably damaging Het
Txlnb A G 10: 17,843,455 D678G possibly damaging Het
Vgll4 A G 6: 114,957,934 probably null Het
Vmn2r124 A T 17: 18,061,925 probably benign Het
Vmn2r2 T C 3: 64,117,399 D587G probably benign Het
Vmn2r84 G A 10: 130,391,099 A290V probably benign Het
Vps13c T A 9: 67,911,529 S1077R probably benign Het
Vsig10 C T 5: 117,351,654 A495V probably benign Het
Vwa3a A T 7: 120,804,031 probably null Het
Zfhx2 C A 14: 55,065,998 A1510S possibly damaging Het
Zfp62 T C 11: 49,217,683 I867T probably benign Het
Other mutations in Zfp142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Zfp142 APN 1 74566972 missense probably damaging 1.00
IGL00711:Zfp142 APN 1 74572434 missense probably damaging 1.00
IGL01391:Zfp142 APN 1 74579540 missense probably damaging 1.00
IGL01808:Zfp142 APN 1 74576025 missense probably damaging 1.00
IGL02074:Zfp142 APN 1 74569863 missense probably damaging 0.97
IGL02134:Zfp142 APN 1 74569863 missense probably damaging 0.97
IGL02567:Zfp142 APN 1 74578147 missense possibly damaging 0.84
IGL02567:Zfp142 APN 1 74578149 missense possibly damaging 0.92
IGL02567:Zfp142 APN 1 74578150 missense possibly damaging 0.92
IGL02669:Zfp142 APN 1 74571273 missense probably benign 0.18
IGL02694:Zfp142 APN 1 74570148 missense probably damaging 0.98
IGL02884:Zfp142 APN 1 74571983 missense probably damaging 0.99
IGL03000:Zfp142 APN 1 74573618 missense probably benign 0.01
IGL03080:Zfp142 APN 1 74571209 missense probably benign 0.18
IGL03238:Zfp142 APN 1 74576278 missense probably benign 0.37
IGL03277:Zfp142 APN 1 74571034 missense probably damaging 1.00
PIT4402001:Zfp142 UTSW 1 74579528 missense probably damaging 1.00
R0124:Zfp142 UTSW 1 74568623 missense probably damaging 1.00
R0256:Zfp142 UTSW 1 74578158 missense probably benign
R0267:Zfp142 UTSW 1 74576064 missense probably benign 0.05
R0306:Zfp142 UTSW 1 74570182 missense probably damaging 1.00
R0321:Zfp142 UTSW 1 74569714 missense probably damaging 1.00
R0466:Zfp142 UTSW 1 74585411 missense possibly damaging 0.95
R0513:Zfp142 UTSW 1 74571555 missense probably damaging 1.00
R1084:Zfp142 UTSW 1 74571826 missense probably benign
R1534:Zfp142 UTSW 1 74572088 missense probably benign 0.00
R1548:Zfp142 UTSW 1 74570104 missense probably damaging 1.00
R1623:Zfp142 UTSW 1 74571775 missense possibly damaging 0.56
R1628:Zfp142 UTSW 1 74571888 missense possibly damaging 0.94
R1722:Zfp142 UTSW 1 74569776 missense probably damaging 1.00
R1770:Zfp142 UTSW 1 74579631 missense probably damaging 0.99
R2042:Zfp142 UTSW 1 74570619 missense probably benign 0.10
R2112:Zfp142 UTSW 1 74573636 missense probably damaging 1.00
R2249:Zfp142 UTSW 1 74567032 missense probably damaging 1.00
R4393:Zfp142 UTSW 1 74572060 missense probably benign 0.00
R4700:Zfp142 UTSW 1 74570272 missense probably damaging 1.00
R4750:Zfp142 UTSW 1 74572458 missense probably damaging 1.00
R4763:Zfp142 UTSW 1 74576512 missense probably damaging 1.00
R5208:Zfp142 UTSW 1 74570868 missense probably benign 0.18
R5233:Zfp142 UTSW 1 74585449 missense probably damaging 1.00
R5585:Zfp142 UTSW 1 74578245 nonsense probably null
R6192:Zfp142 UTSW 1 74570508 missense probably damaging 1.00
R6461:Zfp142 UTSW 1 74567185 missense probably damaging 1.00
R6482:Zfp142 UTSW 1 74570217 splice site probably null
R7320:Zfp142 UTSW 1 74570008 nonsense probably null
R7438:Zfp142 UTSW 1 74585520 missense probably benign
R7528:Zfp142 UTSW 1 74570902 missense probably benign 0.00
R7600:Zfp142 UTSW 1 74573668 missense probably damaging 1.00
R8007:Zfp142 UTSW 1 74571496 missense probably benign 0.01
Z1177:Zfp142 UTSW 1 74570166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGTCCATATTGGAGTTAGCC -3'
(R):5'- TGCCTGCAAGCGGAAGTATGAG -3'

Sequencing Primer
(F):5'- AGCCACAATTTCATGTTCACGG -3'
(R):5'- GAAGCACATGGCTTCCCAG -3'
Posted On2014-05-14